Privacy: Congratulations, aren't you clever?

Congratulations! You successfully decoded the encrypted URL on Science’s cover (or, um, took a shortcut by following a link someone sent you). Below you’ll find a key to the data we embedded in the cover image, which include privacy-related publications and events—and potentially private details about an individual’s health, movements, and behavior. Tweet us @sciencemagazine to tell us you’ve succeeded!

LEFT STREAM

Latitude: 38.900197 | Longitude: -77.0284

Location of AAAS headquarters

goo.gl/O3p2yh

Story in the Daily Mail giving private details about an Ebola patient

44 01625 545 745

Telephone number for the ICO (“UK’s independent authority set up to uphold information rights in the public interest, promoting openness by public bodies and data privacy for individuals.”)

$612.33 at Neiman Marcus

Neiman Marcus is one of several stores that have suffered data breaches.

DOI 10.1073/pnas.0904891106

A paper that describes a way to predict Social Security numbers from public data

http://www.pnas.org/content/106/27/10975.full

ISBN-10: 0370013255

PRIVACY AND FREEDOM by Alan F. Westin (1967). The best book on privacy written in the late 20th century, according to The Washington Post

sku #22616900

Stock keeping unit number for Jimmy Choo Kascade Suede T-Strap Wedge Sandal at Neiman Marcus

078-05-1120

The most misused Social Security number ever, originally printed in a Woolworth’s ad

www.gk2gk.com

“Geek 2 Geek” dating website

CATGTTTTCAGCATTATCAGAAGGA

PCR primer sequence for HIV

MIDDLE STREAM

ISSN 1240-0068

Charlie Hebdo

CTGCTCGCGC TGTGCTGGGC

Sequence from the ApoE4 Alzheimer’s susceptibility gene

sggk://hxrn.zt/hnigbkmgh

Encrypted URL for this page (using the Atbash cipher)

US 4,200,770 

First patent covering a public-key cryptosystem

http://www.emc.com/emc-plus/rsa-labs/standards-initiatives/important-patents-in-cryptography.htm

$19.79 card purchase at Target

Target suffered a major data breach.

sku #08302855

Stock keeping unit number for Jimmy Choo Lottie Suede Crisscross Sandal at Neiman Marcus

ATEOTD IANAC

Text shorthand for “at the end of the day I am not a crook”

DOI: 10.1126/science.1058040

Human genome paper in Science

$273.99 at Kmart

Kmart suffered a data breach.

2G2BT

Text shorthand for “too good to be true”

RIGHT STREAM

COMWBSNS

SWIFT bank code for Commonwealth Bank Ltd. Head Office, Nassau, Bahamas

Latitude: 51.492762 | Longitude: -0.080152 

Location of the United Kingdom’s Secret Intelligence Service headquarters

577-48-0618

Social Security Number for Vannevar Bush, early architect of U.S. science policy, who originated concepts key to the digital age

+441719309000

Phone number for the United Kingdom’s MI5 Security Service

DOI: 10.1111/j.1083-6101.2009.01494.x

Paper on Facebook and Online Privacy: Attitudes, Behaviors, and Unintended Consequences

PubMed ID19581585

Paper on predicting Social Security numbers from public data

http://www.pnas.org/content/106/27/10975.full

http://scim.ag/1NNQB1Y

Science’s privacy quiz

053000196

Routing number for Bank of America

ISBN 978-1-62779-073-4
No Place to Hide, a book about Edward Snowden

goo.gl/fTyARu

World Health Organization report on ethical principles in HIV surveillance

Short interval

Whew, that was a lot of information. But we’re not done yet—we hid some more data inside the issue, too. Below is a key to the information we embedded in page 490 of our 30 January issue. Again, don’t forget to tweet us @sciencemagazine to tell us you’ve succeeded!

WILLIAM DUKE


LEFT STREAM

CYA 2MOR 6Y

Text shorthand for “see you tomorrow, sexy”

Latitude: 36.112024 | Longitude: -115.174593

Location of the Bellagio in Las Vegas

Latitude: 39.356351 | Longitude: -74.435708

Location of Caesars Atlantic City

http://www.sciencemag.org/content/339/6117/321

The 2013 Science paper showing that anonymized public DNA sequences can reveal identities

@maltespitz

Twitter handle for Malte Spitz, German politician concerned about privacy who let a newspaper piece together his entire life and all of his movements for several months based on the records stored by his mobile phone company

PASSWORD

Most used password

IAD-RUH-KHI 

Route code for Washington Dulles-Riyadh-Karachi airports

0090-2020

ISSN for Penthouse magazine

ISBN-10: 0370013255

PRIVACY AND FREEDOM by Alan F. Westin (1967), the best book on privacy written in the late 20th century according to The Washington Post

Rx  51655-013-26

National Drug Code for the cholesterol drug lovastatin

https://firstlook.org/theintercept/

News and comment site with a focus on civil liberties

2306 chapter 858

California bill to protect people from snooping by drones

sku #11183301

Stock keeping unit number for Jimmy Choo Lance Wavy Strap Sandal at Neiman Marcus

AMT DOB 6/23/1912  
Birthday of Alan Turing, cryptographer and father of digital computing

sku #22616919

Stock keeping unit number for Jimmy Choo Kascade Calf Hair Crystal-Strap Wedge Sandal at Neiman Marcus
http://bit.ly/1CegCaN

Link to poster abstract about CacheCloak location cloaking software

0028-0836

ISSN for Nature archive

www.torproject.org

A system to enable anonymous communication on the Internet

021000021

Routing number for JPMorgan Chase Bank

MIDDLE STREAM

<div class="mtm mbs _58mr">Birthday</div><div class="_5k_5"><span class="_5k_4" data-type="selectors" data-name="birthday_wrapper" id="u_0_c">

Code from Facebook’s home page

0100001101101100011000010111010101100100011001010010000001010011011010000110000

Name of Claude Shannon, father of information theory, converted to binary numbers

GATGAGCCC CTGAAAGAGT GTCATATAAA CGAATGCTTG GTAAATAATG

Sequences from the ApoE4 Alzheimer’s susceptibility gene

US 5774670
Patent for the HTTP cookie technology

Miami PD  048305100110  SR874 South (at Turnpike)  HOMESTEAD SB  9/9/2011  3:49:26 AM  00:04:01

Police speeding data

sku #19192067

Stock keeping unit number for Jimmy Choo Aza Woven Leather Pump

0300172311

ISBN number of Nothing to Hide: The False Tradeoff between Privacy and

Security by Daniel J. Solove

http://bit.ly/1KXC9bP

A Google search for “how to protect my privacy”

FHP  109267070110  Lantana  Cypress Creek ORT South    9/11/2011  5:52:20 AM    00:12:47

Police speeding data

sggk://hxrn.zt/hnigbkmgh 

Encrypted URL for this page

id="recaptcha_image" class="captcha_image"></div><div id="recaptcha_loading">Loading...<img class="captcha_loading img"

Code from Facebook’s home page

https://protonmail.ch/
Prototype Swiss e-mail service supposedly safe from eavesdropping

RIGHT STREAM

ISSN 1476–4687

Nature

HNL to HKG to SVO

Routing codes for Edward Snowden’s journey from Hawaii to Russia

http://1.usa.gov/152oCP1

Privacy rule in Health Insurance Portability and Accountability Act

423 Brookline Avenue

Boston address of the Personal Genome Project

TGGCGAGTGC ATCCATAAGA AGTGGCGATG

Sequence from the ApoE4 Alzheimer’s susceptibility gene

<li><a dir="ltr" href="https://pt-br.facebook.com/" onclick="intl_set_cookie_locale

Code from Facebook

Directive 2009/136/EC

E.U. directive on privacy and data protection

121042882

Routing number for Wells Fargo Bank

$97.52 at Home Depot

Home Depot suffered a data breach.

441865223407

Phone number of the RUDY research project, studying rare diseases of the bones, joints, and blood vessels

グーグル株式会社に対する「通信の秘密」の保護に係る措置(指導)

Press release from Japan’s Ministry of Internal Affairs and

Communications about privacy invasions by Google Street View, 2011

03-cv-1801 05-cv-0301 01-cv-4183

Case numbers for three suits against Health Net, a company that accidentally revealed medical and financial information about large numbers of patients

http://www.gk2gk.com/

Geek 2 Geek dating site

sku #19192377

Stock keeping unit number for Jimmy Choo Abel Studded Point-Toe Pump

Rx 0002-3004-75 

National Drug Code for the antidepressant Prozac

(&quot;pt_BR&quot;, &quot;https:\/\/pt-br.facebook.com\/&quot;)

Code from Facebook

http://bit.ly/185Uvbo

A run in the Paris suburbs that somebody posted on Runtastic.com

http://bit.ly/OPF39g

Songs to Sing in the Shower, a popular Spotify playlist

https://my.pgp-hms.org/profile_public?hex=hu1F73AB

The profile of a random participant in the Personal Genome Project