Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.

Site Tools

  • AAAS
  • Subscribe
  • Feedback

Site Search

Search Advanced


Abstract
Full Text
Genetic Evaluation of Suspected Cases of Transient HIV-1 Infection of Infants
Lisa M. Frenkel, James I. Mullins, Gerald H. Learn, Laura Manns-Arcuino, Belinda L. Herring, Marcia L. Kalish, Richard W. Steketee, Donald M. Thea, Joan E. Nichols, Shan-Lu Liu, Abdallah Harmache, Xi He, David Muthui, Anup Madan, Leroy Hood, Ashley T. Haase, Mary Zupancic, Katherine Staskus, Steven Wolinsky, Paul Krogstad, JiaQi Zhao, Irvin Chen, Richard Koup, David Ho, Bette Korber, Raymond J. Apple, Robert W. Coombs, Savita Pahwa, and Norbert J. Roberts Jr.

Supplementary Material


Genetic evaluation of suspected cases of transient HIV-1 infection of infants: Details of patients clinical histories and laboratory studies

Lisa M. Frenkel*1,2 , James I. Mullins3,4, Gerald H. Learn3, Laura Manns-Arcuino2, Belinda L. Herring3, Marcia L. Kalish5, Richard W. Steketee5, Donald M. Thea6, Joan E. Nichols7,8, Shan-Lu Liu3, Abdallah Harmache3, Xi He3, David Muthui3, Anup Madan9, Leroy Hood9, Ashley T. Haase10, Mary Zupancic10, Katherine Staskus10, Steven Wolinsky11, Paul Krogstad12, JiaQi Zhao13, Irvin Chen13, Richard Koup14, David Ho14, Bette Korber15, Raymond J. Apple16, Robert W. Coombs4, Savita Pahwa17 and Norbert J. Roberts, Jr.1,7,8

Departments of 1Pediatrics and 7Medicine, University of Rochester; Department of 2Pediatrics, 3Microbiology, 4Medicine, and 9Molecular Biotechnology, University of Washington, Seattle; 5Centers for Disease Control and Prevention, Atlanta, Georgia; 6Medical and Health Research Association of NYC, Inc.; 8Medicine and Microbiology and Immunology, University of Texas Medical Branch, Galveston; 10Microbiology, University of Minnesota, Minneapolis; 11Medicine, Northwestern University; 12Pediatrics and 13Medicine and Microbiology and Immunology, University of California at Los Angeles; 14Aaron Diamond AIDS Research Center, New York; 15Sante Fe Institute, Sante Fe; 16 Roche Molecular Diagnostics, Alameda, CA; 17Dept. of Pediatrics, North Shore University, Manhasset, NY.

*Address correspondence to:
Lisa M. Frenkel, M.D.
University of Washington, Dept. of Pediatrics, Division of Infectious Diseases
4800 Sand Point Way, N.E.; Box 329500
Seattle, WA 98105
Tel (206) 526-2116, fax (206) 527-3890, email lfrenkel@u.washington.edu

Analysis of Transient Viremia in a Mother and Her Child. HIV-1 infection was diagnosed in a woman by serologic testing in 1988, and cultures of her peripheral blood mononuclear cells (PBMC) (1) grew HIV-1 3.6 and 3.8 years later. Her first child was born in 1990 and was HIV-1 culture positive at five, seven and eleven months of age. However, from the time of their last positive cultures in 1991 and 1992 through 1994, five cultures of the child's and seven of the mother's PBMCs, respectively, were negative, including one from each that was depleted of CD8+ cells to facilitate HIV-1 growth (2). Also during this time, all six of the mother's and all eleven of the child's blood samples were negative for HIV-1 env (3) and pol (4) gene sequences by nested PCR (nPCR) in one laboratory and two specimens from each subject were negative for gag by nPCR in the New York State Laboratory (5). Sera and plasma from the mother and child during this time were HIV-1 negative for antibodies by enzyme-linked immunosorbent assay (Genetic Systems, Seattle, WA), although low levels of antibodies to HIV-1 p24 Ag, p55 and p61 were occasionally detected by Western blot (Organon Technica, Raleigh-Durham, NC) of the mother's and child's sera (data not shown). Their CD4+ cell values were normal throughout and both have remained healthy.

The mother's lymph nodes were biopsied 3.2 and 3.8 years after her first negative HIV-1 culture in an effort to confirm a low level of HIV-1 infection. The lymph nodes were examined for evidence of HIV-1 RNA by in situ hybridization and viral DNA by in situ PCR. Lymph nodes were fixed, embedded and analyzed for the presence of HIV-1 DNA and RNA by in situ PCR and hybridization, respectively, following modification of protocols previously described (6). The in situ PCR used a multiple primer set designed to amplify 1274 nucleotides of HIV-1 gag (338-1611, HIVHXB2R). The primer set is composed of three primer pairs (5'-tgggtgcgagagcgtcagtattaagcggggg-3', 5'-gtgatatggcctgatgtaccatttgcccct-3'; 5'-gtcagccaaaattaccctatagtgcagaac-3', 5'-acatagtctctaaagggttcctttggtcct-3'; 5'- tagtaagaatgtatagccctaccagcattc-3', 5'-aatctttcatttggtgtccttcctttccac-3') that generate consecutive products (450-500 base pairs) with overlapping cohesive termini; a strategy that allows for both efficient amplification of smaller products from the template DNA and production of larger molecules that are preferentially retained at the site of synthesis. In addition, the two primers located at the ends of the 1274 nucleotide region were present in the PCR reaction at a 100-fold molar excess over the internal primers to favor amplification of large DNA in later cycles. Amplification (40c: 92C x 30", 60C x 30", 72C x3') was performed in a BioOven thermal cycler (BioTherm Corp., Fairfax, VA) using Gene Cones (Gene Tec Corp., Durham, NC) as specimen reaction chambers. Amplified DNA was detected by in situ hybridization with a PCR-generated 35S-labeled DNA probe specific for sequences internal to, but not including, the in situ PCR primers. RNA was assayed by in situ hybridization with a random-primed radiolabeled DNA probe representative of the complete genome. After hybridization the sections were coated with NTB2 nuclear track emulsion (Kodak, Rochester, NY), exposed, developed, counter stained with hematoxylin/eosin and examined by light microscopy. No HIV-1 DNA or RNA was identified in the lymph node from either date.

Tissue from the second biopsy was also assayed for HIV-1 gag, pol and env DNA in 178 nPCR reactions in solution using a total of 10 combinations of first and second round primers. DNA extracted from the lymph nodes removed in 3/95 totaling 178ug, equal to 27 million cells, was assayed for HIV-1 sequences by PCR using 1ug of purified DNA per assay (7). Multiple nested primer sets for env (first round products from 600-3,000bp, second round products spanning from the 1.2kb V1-V5 region to as small as 0.3kb V3 region), and one nested primer set each for pol and gag were used. Each assay was sensitive in detecting approximately one copy of HIV-1 in 1ug of negative control DNA as determined by positive control reactions run in parallel in each experiment. env primers used for first round amplification were ED5 and ED12 or ED3 and ED14 or ED3 (8) and Nef3 (5'-taagtcattggtcttaaaggtacc, positions 9004-9028 of the HXB2 genome) or JA9 and JA12 (3). First round material from ED5/ED12 amplification was then used as template in second round reactions using primer sets ED31/ES8 (n=4 reactions), ES7/ES8 (n=36), ES7/ED33 (n=14) (8), JA10/JA11( n=5) (3) and ES7/ES8 followed by JA10/JA11 in a third round (n=5). First round amplification products from ED3/Nef3 primers was used in second round reactions with primer sets ES7/ES8 (n=13) and ED5/ED12 (n=5), ED3/ ED14 were used in the first round plus ED5/ED12 in the second (n=27), as were JA9/JA12 products amplified in a second round by JA10/JA11 (n=19). gag amplifications employed primers 3'gag (5'gactagcggaggctagaagg, positions 2382-2363 of HXB2) and 5'gag (5'ggtttccatcttcctggcaa, positions 763-782) in the first round followed by SK145 (9) and DR150- (5'-agttcctgctatgtcac; 1505-1476 on the HXB2 genome) in the second round (n=20). pol amplifications employed primers RT1 and RT2 in the first round and RT3 and RT4 (10) in the second round (n=30). Mixtures of the extracted lymph node DNA with positive control 8E5 cells showed the lymph node was free of inhibitors of the PCR assay. The JA10/11 primers for a 300bp region of V3 of env occasionally yielded a 280bp product, however, no homology with HIV-1 sequences were found on sequence analysis of this fragment. Two of the 178 reactions yielded product of the expected molecular weight, however, each was sequenced and found to be carryover product from the positive control (HIV-1-LAI). No HIV-1 was amplified in the remaining 176 PCR reactions containing lymph node DNA or in the negative control specimens. Thus, virus was not detected by either approach and lymph node histology was normal. The absence of HIV-1 DNA and RNA in the lymph node is in stark contrast to HIV-1 seropositive asymptomatic individuals, where both are easily detected (11, 12).

The only blood specimen banked in the 1990-91 period from these two individuals was plasma from the child from the day of his last positive culture in 1991. It was thawed and tested along with more recent specimens from this Caucasian child for independently segregating loci including HLA-DQA1, low-density lipoprotein receptor (LDLR), glycophorin A (GYPA), hemoglobin G gammaglobin (HBGG), D7S8, and a group-specific component (GC) (AmpliType PM PCR Amplification and Typing Kit, Roche Molecular Diagnostics, Alameda, CA) to evaluate the identity of the 1991 specimen. The combined power of discrimination for these six markers for Caucasians in the United States is 0.9997. While the somatic genetic loci of the 1991 specimen matched a recent sample from the child, nPCR testing failed to detect the presence of viral gag, pol or env sequences. For these studies, RNA was extracted from 500 ul of plasma with QIAamp HCV RNA kit (QIAGEN GmbH, Germany), according to the manufacture's instruction followed by reverse transcription (RT) using 250 pmol of random primer plus 10 pmol of ED33 and 200U SuperScript-TM II RNase H free reverse transcriptase (Life Technologies, Bethesda, MD) in a 25 ul reaction at 42C for 1 hour. For the env gene, ED31 and ED33 were used as the first round primers, JA10 and JA11 were used for the second round. For the gag gene, several primer sets were employed, among which the smallest size fragment was 115bp by using SK38 and SK39 (13). PCR conditions for all reactions were: 3 cycles of 94C for 1 min., 55C 1 min., 72C for 1 min., followed by 32 cycles of 94C for 15 sec., 55C for 45sec., 72C for 1 min. The last cycle of each round was followed by incubation for 5 min. at 72C. Repeated amplifications, however, failed to produce HIV-specific products in reactions where the positive and negative controls worked properly.

Assays to detect HIV-1-specific cellular immunity were conducted in 1994, 3 and 3.5 years, respectively, after the mother's and child's last positive culture, to potentially provide evidence of preceding HIV-1 infection by correlates of immunity, most notably HIV-specific cytotoxic T lymphocyte (CTL) activity (14, 15). PBMC from both individuals demonstrated HIV-1-specific lymphocyte proliferative responses (Table 1), which suggested prior sensitization to HIV-1 antigens (16).

While a high frequency of circulating HIV-1-specific CTL in HIV-1 infected individuals has been measured in unstimulated PBMC (17, 18), a less vigorous response, similar to other viruses (17, 19, 20), was anticipated in our subjects who did not have detectable circulating HIV-1. Thus, in vitro stimulation as well as a high effector:target cell ratio was used to improve detection of HIV-1-specific CD8+ T cell-mediated CTL activity (2). CD8+ CTL were stimulated in vitro using psoralen-uv-inactivated whole HIV-1 obtained from the NIAID AIDS Research and Reference Reagent Program. Vaccinia and recombinant vaccinia constructs were kindly provided by Dr. Dennis Panicali, Therion Biologics Corp., Cambridge, MA, and used to infect the target cells. Stimulation of precursor CTL with inactivated HIV was chosen to avoid in vitro boosting of vaccinia-specific CTL activity, and also served to avoid boosting of any potential responsiveness to EBV antigens since autologous EBV-LCL were to be used as target cells.

The child's cells contained HIV-1-specific precursor CTL (pCTL), detectable in each of three separate micro-CTL assays conducted between 2/94 and 7/94, to multiple HIV-1 antigens (Table 2). The mother's cells, assayed at a single time point, also showed HIV-1-specific CTL activity (Table 2). This HIV-1-specific CD8+ CTL activity, which was consistently detected using samples of limited cells, provides evidence of preceding HIV-1 sensitization. Lysis was measured using a micro-CTL assay with 103 target cells per well, an effector-to-target (E:T) ratio of 100:1, and autologous EBV-LCL (lymphocytic cell line) target cells infected with vaccinia virus or the recombinant vaccinia constructs (2, 20). Micro-CTL assays were performed in parallel with each of the assays shown in Table 2 in order to identify the effector cell responsible for CTL activity. Sample limitations prevented extensive analysis, but provided preliminary data regarding CTL populations of the subjects. For effector cell identification, immunomagnetic bead (Dynabeads, Dynal, Inc., Great Neck, NY) depletions of CD4+ and CD8+ cells, as well as sham depletion, were used along with an effector:target ratio of 50:1 in a micro-assay for CTL activity (2, 20). Lysis of autologous vaccinia-infected and vaccinia-envLA1/gag/pol-infected target EBV-LCL was measured. Lysis that ranged from 10 to 18% with sham depletion, using anti-murine immunoglobulin tagged magnetic beads, was reduced consistently to zero by immunomagnetic depletion of CD8+ effector cells, and was reduced to a lesser extent and not as consistently by depletion of CD4+ effector cells, suggesting HIV-1 specific CTLs were primarily CD8+ cells.

Notably, the methods used to assess in vitro CTL activity have been used by us and others to test a large number of volunteers not exposed to HIV-1, including those who later received candidate AIDS vaccines, in the AIDS Vaccine Evaluation Group (AVEG) trials. These volunteers have shown no HIV-1-specific CTL activity before vaccination, after inactivated subunit vaccine preparations, or after in vivo priming with vaccinia-envelope, except when the latter volunteers were boosted subsequently with purified recombinant gp160 (2). We used methods to measure CTL activity, with criteria for response determined for current AVEG trials, that rarely (and only transiently) elicit 10% HIV-specific lysis using cells from unvaccinated, uninfected individuals, or cells from individuals receiving HIV subunit vaccine preparations (21). CTL showing 15% HIV-specific lysis from such individuals would be exceedingly rare based on the vaccine trial data. These data indicate that it is unlikely that the immunologic response detected in the mother's and child's cells reflect a primary in vitro sensitization or cross reactive responses to HIV-1 gene products.

Resistance to HIV-1 infection on the basis of a homozygous deletion within the CCR5 gene (22) was also excluded when both the mother and child were found to be homozygous wild-type.

To evaluate the link between the viruses isolated from the women and the child in 1990-91, sequence analysis of the V3-V5 region of HIV-1 env was performed. Previous analysis conducted in a single laboratory had suggested genetic relatedness of HIV-1 regrown from the child's three positive and one of the mother's two positive culture supernatants (23), whereas the mother's second isolate had been found to be genetically related to the laboratory strain, HIV-1 LAI/IIIB. Subsequently, three aliquots each of the five culture supernatants frozen since 1990-91 were analyzed. Each aliquot was regrown at separate times, and viral DNA from the mother and child's cultures was PCR-amplified and sequenced in separate laboratories to eliminate the possibility of cross contamination. A 650bp region of HIV-1 env was amplified by nPCR using primers ED5/12 and ES7/8 (24). The products were cloned into PCRII (Stratagene, Inc., La Jolla, CA), and 4-6 clones from each isolate sequenced using dye-labeled terminators (Applied Biosystems, Inc, Foster City, CA). Sequences were aligned using the program CLUSTALW (25) followed by manual adjustment using GDE (26). Sequence regions that could not be unambiguously aligned were removed from subsequent analyses. Genetic distances were calculated with DNADIST from the PHYLIP software package, using the maximum likelihood method (27) was constructed using these distances, and a bootstrap analysis (26) using 1000 bootstrap replicates was performed to assess the support at each of the internal nodes of the tree. Potential sample mix-ups were evaluated as described (28). Close genetic similarity of viral sequences was observed between the three aliquots from each viral isolate (data not shown). None of the five isolates, however, were closely linked by phylogenetic analysis. Four showed no genetic linkage to viruses within the published or local databases and the fifth was again closely related to the laboratory strain, HIV-1 LAI/IIIB. Although improbable, these virus isolates appear to have arisen from five separate incidents of specimen contamination or mislabeling in 1990 and 1991. Furthermore, the demonstration of similarity between the sequences in the initial analysis (23) most likely resulted from cross-contamination in the DNA preparations or PCR.

While HIV-1 infection could not be confirmed in the mother, her cellular immune response could have resulted from sexual exposures to HIV-1 by at least two partners, one of whom has since died with AIDS. The origin of her child's cellular immune response, however, remains most perplexing.

Details of the analysis of potentially transiently HIV-infected infants in the CDC/NYC Perinatal HIV Transmission Collaborative Study. Specimen mislabeling was revealed in five cases by testing of multiple specimens from each infant for concordance of Human Leukocyte Antigen Class II (HLA-D) gene region DQa. HLA concordant but PCR discordant samples were tested by nPCR, sequencing, and phylogenetic comparisons of the discordant infant specimen and the mother's delivery specimen. Primary PCR reactions for sequencing were performed in a specimen clear room using either the primer sets MK369/MK616 or MK603/MK602 (29). Amplified DNA used as template for the second round of nPCR were opened in a second room used only for the setup of nPCR reactions. No viral cultures or cloned DNA were manipulated in this second room. MK650/MK601 primers were used for all second round reactions. Mothers' and infants' specimens were amplified on different days, by themselves, to reduce the possibility of cross contamination. Direct sequencing of 345 nucleotides of the V3 and flanking regions was done on an automated sequencer and phylogenetic analysis was performed as described (30).

Details of analysis of potentially transiently HIV-infected infants in the Ariel Project for the Prevention of Transmission of HIV from Mother to Infant. 210 children born to 206 HIV-1 infected mothers were followed to determine their infection status using DNA PCR and virus isolation from PBMC and plasma specimens taken over the first 78 weeks of life (31). 190 infants with ultimately negative infection status, had an average of 5.6 PBMC specimens assayed by DNA PCR (range 2-9) and 6.5 PBMC specimens were cultured (range 5-8). Plasma specimens from these infants were all culture (n=332) and RNA PCR (n=23) negative (31). Thirty infants had one or more positive PBMC cultures or PCRs, 21 of which were available for reanalysis (see journal article). An additional 12 infants had discordant duplicate PCR results, each of which was negative upon retesting. And, nine additional infants' umbilical cord specimens were virus positive, however, due to the possibility of contamination with maternal blood, were not evaluated for possible transient viremia. To prevent sample mix-up or contamination, culture or PCR positive infant specimens were cloned and sequenced in the J.I.M. laboratory, whereas maternal specimens were subjected to PCR in the L.M.F. laboratory, and then cloned and sequenced in the L.H. laboratory.

References

  1. F. B. Hollinger, J. W. Bremer, L. E. Myers, J. W. Gold, L. McQuay, J Clin Microbiol 30, 1787-94 (1992).
  2. N. El-Daher, M. C. Keefer, R. C. Reichman, R. Dolin, N. J. Roberts Jr., J. Infect. Dis. 168, 306-313 (1993).
  3. J. Albert, E. M. Fenyö, J. Clin. Microbiol. 28, 1560-1564 (1990).
  4. L. M. Frenkel, et al., Clin. Infect. Dis. 20, 1321-1326 (1995).
  5. A. A. Wiznia, et al., J. Pediatr. 125, 352-353 (1994).
  6. J. Embretson, K. Staskus, E. Retzel, A. T. Haase, P. Bitterman, in The Polymerase Chain Reaction K. B. Mullis, F. Ferre, R. A. Gibbs, Eds. (Birkhauser, Boston, 1994) pp. 55-64.
  7. E. L. Delwart, M. P. Busch, M. L. Kalish, J. W. Mosley, J. I. Mullins, AIDS Res. and Hum. Retrovir. 11, 1181-1193 (1995).
  8. E. L. Delwart, B. Herring, A. G. Rodrigo, J. I. Mullins, PCR Methods and Applications 4, S202-216 (1995).
  9. S. Kwok, et al., Nucleic Acids Res. 18, 999-1005 (1990).
  10. L. M. Frenkel, L. E. n. Wagner, S. M. Atwood, T. J. Cummins, S. Dewhurst, J. Clin. Microbiol. 33, 342-347 (1995).
  11. J. Embretson, et al., Nature 362, 359-362 (1993).
  12. G. Pantaleo, et al., Nature 362, 355-358 (1993).
  13. S. Kwok, et al., J.Virol. 61, 1690-1694 (1987).
  14. C. R. Rinaldo, et al., J. Virol. 69, 5838-5842 (1995).
  15. B. F. Haynes, G. Pantaleo, A. S. Fauci, Science 271, 324-328 (1996).
  16. M. C. Keefer, W. Bonnez, N. J. Roberts, Jr., R. Dolin, R. C. Reichman, J. Infect. Dis. 163, 448-453 (1991).
  17. B. D. Walker, F. Plata, AIDS 4, 177-184 (1990).
  18. B. Autran, F. Plata, P. Debre, J. Acquir. Immune Defic. Syndr. 4, 361-367 (1991).
  19. A. J. McMichael, B. A. Askonas, Eur. J. Immunol. 8, 705-711 (1978).
  20. N. El-Daher, J. E. Nichols, N. J. Roberts, Jr., Clin. Diagn. Lab. Immunol. 1, 487-492 (1994).
  21. M. J. McElrath, R. F. Siliciano, K. J. Weinhold, AIDS Res. Human Retrovir. 13, 211-216 (1997).
  22. R. Liu, et al., Cell 86, 367-377 (1996).
  23. L. M. Frenkel, J. E. Nichols, L. E. Wagner , A. T. Haase, N. J. Roberts Jr, J. Cellular Biochem. 21B, 324 (1995).
  24. E. L. Delwart, et al., Science 262, 1257-1261 (1993).
  25. J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673-4680 (1994).
  26. S. W. Smith, R. Overbeek, C. R. Woese, W. Gilbert, P. M. Gillevet, CABIOS 10, 671-675 (1994).
  27. J. Felsenstein, Ann. Rev. Genet. 22, 521-65 (1988).
  28. G. H. Learn, et al., J. Virology 70, 5720-5730 (1996).
  29. G. Schochetman, S. Subbarao, M. L. Kalish, in Viral Genome Methods A. KW, Ed. (CRC Press, Boca Raton, Florida, 1996) pp. 25-41.
  30. H. W. Jaffe, et al., Ann. Intern. Med. 121, 855-859 (1994).
  31. Y. Cao, et al., Nature Med. 3, 549-552 (1997).

Table 1
StimulantMother (7/94a)Mother (7/94b)Child (2/94)
Thymidine incorporation, cpm
Medium alone3,496 4058
Stimulation indices
Phytohemagglutinin, 1 ug/ml1.931.0398.7
Tetanus toxoid, 2.5 ug/ml1.427.855.2
HIVLA1rgp160, 1.0 ug/ml (baculovirus-produced)3.95.211.4
Baculovirus control antigen1.11.11.6
psoralen-uv-inactivated HIVLAI2.02.313.7
psoralen-uv-inactivated HIVMN1.51.55.4

Lymphocyte proliferative responses to HIV-1 antigens were detected in the mother and her child. Responses to HIV-1 and control antigens were assayed (2, 16) using one fresh, unfrozen sample from each subject. The initial assay of the mother's cells (dated 7/94a) showed a high background 3H-thymidine incorporation (cells cultured in medium alone), potentially obscuring antigen-specific responses. Cryopreserved cells from the same venipuncture sample were available (dated 7/94b) and when assayed at a later date, showed normal background proliferative activity and detectable mitogen- and antigen-stimulated responses, SI > 3.


Table 2
Percent lysis
Target cell infectionMother (7/94)Child (2/94)Child (6/94)Child (7/94)
Vaccinia0000
Vaccinia-envLAI/gag/pol24263721
Vaccinia-envLAI 49
Vaccinia-envMN0
Vaccinia-gag30
Vaccinia-pol35
Vaccinia-nef2211
Vaccinia-vpu26
Vaccinia-vif60

Cytotoxic T cell (CTL) activity to HIV-1 antigens were detected in the PBMC from the mother and her child. Responses shown are percent lysis of target cells above vaccinia background by in vitro boosted PBMC (assayed 7-10 days after stimulation with inactivated HIV-1).


To Advertise     Find Products


Science. ISSN 0036-8075 (print), 1095-9203 (online)