Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.


Science 18 January 2002:
Vol. 295. no. 5554, pp. 472 - 476
DOI: 10.1126/science.1065780


Abstract
Full Text
Spider Silk Fibers Spun from Soluble Recombinant Silk Produced in Mammalian Cells
Anthoula Lazaris, Steven Arcidiacono, Yue Huang, Jiang-Feng Zhou, François Duguay, Nathalie Chretien, Elizabeth A. Welsh, Jason W. Soares, and Costas N. Karatzas

Supplementary Material

Plasmid Construction. All molecular manipulations were carried out following standard procedures (1). All DNA cloning manipulations were performed using E.coli STBII competent cells (Canadian Life Science, Burlington, Canada). Restriction and modifying enzymes were purchased from New England BioLabs (Mississauga, ON, Canada) unless otherwise specified. Construct integrity was verified using DNA sequencing analysis provided by Queens University (Kingston,ON, Canada) or McMaster University (Hamilton, ON, Canada). Primers were synthesized by Dalton Chemical Inc (North York, ON, Canada). PCR was performed using Ready-To-Go PCR beads (Pharmacia Biotech, Baie d'Urfé,PQ, Canada) or Dynazyme kit (MJ Research, MA). In all expression vectors constructed the spider silk sequences were under the transcriptional control of a strong constitutive promoter followed by a secretion leader in order to direct efficient trafficking and secretion of recombinant proteins from the mammalian cells. ADF-3His, contains an in frame carboxyl terminal fusion with a c-myc epitope and six-Histidine tag to facilitate detection and purification, respectively.

Construction of ADF-3His vector. The ADF-3 gene sequence was PCR amplified from the plasmid BLSK-ADF-3 (provided by Dr. Goseline). Two primers (primer 1: 5'-CGTACGAAGCTTAT GCACGAGCCGGATCT G 3'; primer 2: 5'- ATTAACTCGAGCAGCAAGGGCTTGA GCTACAGA 3') were designed according to ADF-3 sequences (2). Primer 1 contains a HindIII site and primer 2 was designed to incorporate an XhoI site. The PCR product was digested with HindIII and XhoI, purified using QiexII matrix (Qiagen, Chatsworth, CA, USA) and cloned into the pSecTag-C vector (Invitrogen, CA, USA) between the HindIII and XhoI sites. Construction of ADF-3 vectors: The ADF-3His construct was modified in order to remove the myc, His sequences and 15 amino acid non-silk sequences present at the N-terminal. A linker containing an XhoI overhang (linker 1: 5'TCGAGCTTGATG TTT 3') was cloned into the ADF-3His expression cassette between the XhoI and PmeI sites. The 15 amino acid non-silk sequences at the 5' end of the vector was removed by inserting a linker (linker 2: 5'-CAGGATCTGGACAACAAGGACCCGGACAACAAG GACCCGGACAACAAGGACCCGGACAACAAGGACCATATGGACCCGGTGCAT CCGCCGCAGCAGCAGCCGCTGGAGGTTATGGACCCGGATCTGGACAACAAG GACCCAGCCAAC AAGGACCTGG 3') into the above vector between the SfiI and MscI sites. Concatamerization of ADF-3 coding region: The ADF-3 coding region was released (MscI and PvuII: 1.4kb) and subcloned into the same vector between MscI and PvuII site. Using the same procedure, three copies of the ADF-3 coding region were inserted into the vector. Construction of MaSpI vector: The MaSpI gene was isolated from the bluescript-MaSp1 plasmid (3) (provided by Dr. Lewis). First the 3'-end was modified with the addition of a PmeI site after the stop codon(position: 3065bp) by inserting a linker (5' ctaggttaagtttaaacg) in between the AvrII and BamHI sites. A 2kb HindIII/ PmeI MaSpI insert was released and cloned into the HindIII/PmeI sites of pSecTag. Since the MaSpI cDNA was not in frame with the Ig-kappa signal peptide, a linker was inserted to correct the reading frame. Concatamerization of MaSpI cDNA: The MaSpI vector was digested with BbsI and the ends were filled in using T4 DNA polymerase in the presence of dNTP's. The MaspI coding sequence was released with SacI and cloned into the MaspI vector between the SacI and a blunt ended ApaI site. Construction of MaSpII vector: The MaSpII gene cDNA sequence was isolated from the plasmid bluescript-MaSp2 (3). This plasmid was modified at the 5'-end, in order to introduce an ApaI site, by digesting with BamHI followed by Mug Bean Exonuclease treatment. A linker (primer 1: 5' AGCGGGCC CGCTCTTC; primer 2: GAAGAGCGG GCCC ) was cloned into the Sap I site, generating an ApaI site. A second linker (primer 1: 5' GCAGCAGCAG; primer 2: 5'GGGCTGCTGCTGCGGCC) was then cloned in between the ApaI and SapI sites, allowing the 5' end of MaSpII to be in frame with ORF of the pSecTag secretion signal sequence. The 3' end was modified, in order to introduce a PmeI site, by inserting a linker (primer 1: 5' TGAAATTTCG; primer 2: 5' AATTCGAAATTTCATGCA) in between the EcoRI and NsiI sites. The vector was then digested with NaeI and EcoRV, to remove the ApaI site and re-circularized. The final construct was digested with ApaI and PmeI and the 2kb MaSpII insert was cloned into the Masp1 expression vector between ApaI and PmeI.

Transfection and selection of stable cell lines. MAC-T cells (4) are mammary epithelial cells that were selected primarily for two reasons: (a) they are secretary epithelial cells, similar to the cell type that expresses silk proteins in the spider glands (5), and (b) since they mimic ruminant lactation they can provide preliminary information in terms of the capacity of mammary epithelial cells to efficiently secrete soluble spider silks in the milk of transgenic animals.

In brief, MAC-T or BHK cells were transfected with Lipofectamine (Canadian Life Science) as per manufacture's recommendations using 10nameg of the plasmid DNA diluted into 0.25ml of DMEM and mixed with an equal volume of Lipofectamine (20nameg of lipid in 0.25ml DMEM). Stable transformants were selected in DMEM containing 10% foetal calf serum and 100nameg/ml hygromycin B (Canadian Life Science). Colonies surviving selection were picked after 7-8 days following transfection and expanded further. In general, the results indicated that under the culture conditions tested, BHK cells transfected with the spider silk constructs expressed higher amounts of the rc-ADF-3 proteins than the MAC-T cells.

Hollow Fiber system: Unisyn's Cell-Pharm ® System 2500TM hollow fiber cell culture system was used for the production and continual recovery of mammalian secreted rc- spider silk proteins. Typical production of rc-spider silk protein using the hollow fiber system was achieved for up to 3 months.

Generation of Polyclonal Antibodies against Dragline Spider silk proteins. Antibodies were raised in rabbits against both purified rc-spider silk protein (BHK derived material) and synthetic peptides designed based on sequences of N. clavipes and A. diadematus. Peptide synthesis, conjugation, immunization, bleeding and serum preparations were carried out by Strategic BioSolutions (Ramona, CA). The immunising peptide sequences were anti-MaSpII, GLGSQGAGRGGQGAGA-NH2, anti-ADF-3, ARAGSGQQGPGQQGPG-NH2.

Detection of rc-spider silk in media and purified fractions. Quantitation of rc-spider silks in conditioned media involved SDS-PAGE and immunologic evaluation (Western blotting analysis) (6). Serum free conditioned media was harvested from cells at 70-80% confluency at 24hrs. An aliquot of 20namel was loaded onto 8-16% Tris-Glycine gels(Novex, Invitrogen), electrophoresed and transferred by electroblotting onto nitrocellulose membrane. Rc-spider silk immunoreacting proteins on the membrane were detected using rabbit polyclonal antibodies raised against ADF-3 or MaSpI (1:5000 dilution) and goat anti-rabbit horseradish peroxidase conjugated 2nd antibody. Detection was performed according to the manufacture's protocol using enhanced chemiluminescence (ECL) detection (Amersham/Pharmacia). For silver stain analysis, gels were stained using GelCode SilverSNAP (Pierce, IL) kit, as described by manufacturer. Samples were prepared by adding 10M urea to a final concentration of 6M, loading buffer containing name-mercaptoethanol and heating for 5 min at 95°C prior to loading. In the absence of urea aberrant migration of rc-spider silk protein was observed.

Purification of rc spider silk proteins. ADF-3His purification: The conditioned cell culture media was adjusted to contain 6M urea and then loaded onto a Ni-NTA column (Qiagen,Chatsworth,CA,USA) and processed as described by manufacture. Bound proteins were eluted using wash buffer containing 100mM imidazole. Eluted fractions were analysed as described above. Purification of ADF-3: Conditioned culture media was filtered using a 0.45 namem filter, brought to a final concentration of 20% (w/v) ammonium sulfate and incubated for 1 hour at 4°C.Precipitated proteins were recovered by centrifugation at 20,000g at 4°C for one hour. The protein pellet was gently resuspended in buffer A (20 mM glycine, pH10) and insoluble material was removed by a brief centrifugation. The pH of the sample was adjusted to 10 using NaOH (10N), and conductivity was adjusted to 1.2 mS by diluting the sample with Buffer A. An anion exchange column of 5x11 cm was packed with POROS HQ50 resin (PE Biosystems, USA) and equilibrated with 10 column volumes of buffer A. The sample was loaded onto the column at a flow rate of 100 ml/h. The column was then washed with 5 column volumes of buffer A and ADF-3 protein eluted using 3 column volumes of buffer A containing 0.15M NaCl.

Purity assessment. The purity of the rc-silk protein was analyzed using silver staining , RP-HPLC (4) and amino acid composition. The peak containing ADF-3 protein on RP-HPLC was identified by Western blot analysis. Purity was estimated using peak area integration. Amino acid composition was performed as previously described (7 ).


Supplemental Table 1. Amino acid Analysis of purified rc-ADF-3 Amount of ADF-3 present in purified material: 96.93%
Amino Acids
Expected
Actual
Difference
mmolesmole %mmolesmole %mole %
ASX0.640.64%1.0581.51%0.87%
GLX17.1717.22%13.06818.65%1.43%
SER9.229.25%6.8399.76%0.51%
GLY32.2732.37%21.91331.28%-1.09%
HIS0.160.16%0.1100.16%0.00%
ARG0.480.48%0.4440.63%0.15%
THR0.480.48%0.5100.73%0.25%
ALA16.3816.43%10.27114.66%-1.77%
PRO13.0413.08%8.52012.16%-0.92%
TYR4.134.14%2.5713.67%-0.47%
VAL2.862.87%1.9952.85%-0.02%
MET0.160.16%0.1670.24%0.08%
CYS0.160.16%0.2750.39%0.23%
ILE0.640.64%0.6020.86%0.22%
LEU1.751.76%1.3181.88%0.13%
PHE00.00%0.1590.23%0.23%
LYS0.160.16%0.2350.34%0.17%


Quantitation of purified rc-spider silk proteins. Purified material was quantitated using the extinction coefficient method (at 280nm) (8).

Spin dope preparation. ADF-3His spin dopes containing up to 18% (w/v) protein were typically prepared by dialyzing Ni-NTA purified protein into buffer A (160 mM urea, 10 mM NaH2PO4, 1 mM Tris, pH 5) with 20 mM NaCl and reducing the volume by ultrafiltration using 10,000 MWCO membranes (Millipore, Bedford MA). Insoluble material, ranging from 5-50% of total protein, was removed by centrifugation at 16,000g for 5 minutes (20°C). Purified ADF-3 protein was dialyzed against buffer A with 10-mM glycine, the volume was reduced by ultrafiltration through YM10 membranes to achieve a concentrated spin dope up to 28% w/v. At each step insoluble material was removed by centrifugation at 16,000g for 5 minutes (20°C).

Microscopy Fibers were observed microscopically using a model Optiphot2-pol polarizing microscope (Nikon Corp, Garden City NY) to determine diameter and appearance. Fibers were viewed for birefringence under polarizing light, using a first-order red plate at 530 nm. Fibers were also examined using a scanning electron microscope (SEM). The samples were coated 1X with gold/palladium and viewed on a Carl Ziess CSM 950 SEM (Germany) at 10KeV. The samples were tilted at a 15° angle toward a SE detector.

Fiber testing. Denier determination was done using a Vibramat M (TEXTECHNO Herbert Stein GmbH Co., Monchegladbach, Germany) or by polarizing light microscopy. An average fiber diameter was determined by microscopy from a minimum of five diameter readings along the fiber, which was used to calculate fiber denier. Samples were stored in a box at ambient temperature and 50-55% relative humidity. Mechanical testing was performed using the Instron Model 55R4201 (Instron Corporation, Canton MA) at 23°C and 50% relative humidity. Samples 1/2" in length were tested from fibers typically 6-12" in length. Mechanical properties were determined using the Instron software Series IX Automated Materials Testing System.


References

  1. Sambrook, J., Fritsch, E.F. & Maniatis, T. Molecular cloning:a laboratory manual. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY;1989).
  2. P.A. Guerette, D.G. Ginzinger, B.H.F. Weber, J.M. Gosline, Science 272,112 (1996).
  3. M. Xu, R.V. Lewis, Proc. Natl. Acad. Sci. 87,7120 (1990).
  4. H.T. Huynh, G. Robitaille, J.D. Turner, Exp. Cell Res. 197,191 (1991).
  5. F. Lucas, Discovery 25,20 (1964).
  6. Coligan,J.E. et al. Current Protocols in Protein Science. (John Wiley and Sons, Inc, NY; 2000).
  7. R.L. Heinrikson and S.C.Meredith, Anal. Biochem. 136,65 (1984).
  8. S.C. Gill, P.H. von Hipple, Anal. Biochem. 182, 319 (1989).





To Advertise     Find Products


Science. ISSN 0036-8075 (print), 1095-9203 (online)