Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.


Science 26 October 2001:
Vol. 294. no. 5543, pp. 862 - 864
DOI: 10.1126/science.1065329


Abstract
Full Text
An Extensive Class of Small RNAs in Caenorhabditis elegans
R. C. Lee and V. Ambros

Supplementary Material

A. Methods:

Worm Culture

Wild type C. elegans N2 worms were grown on "Special" NGM plates supplemented to 2.5% agar and 1% peptone. After consuming the OP50 bacterial lawn on the plate, they were fed concentrated bacteria until they reached the adult stage. They were then rinsed off the plates and filtered sequentially through 40 micron and 20 micron mesh nylon. This dispersed any contaminating bacteria and selected for gravid adults. The two filtrates were rinsed into a 50 ml centrifuge tube, spun at 750g in an IEC clinical centrifuge for 60 seconds, and the supernatant aspirated. The tube was filled with a solution of 0.5NKOH, 0.8-1.2% NaOCl (1:5 dilution of sodium hypochlorite) and vortexed for one minute, then spun immediately at 750g for 30 seconds. The supernatant was aspirated and 25 ml of fresh hypochlorite solution added. The mixture was vortexed one minute, then the tube was filled with ice cold M9 and spun for 30 seconds. The supernatant was aspirated and the pellet was washed 3 more times (50 ml ice cold M9 each time, vortexing well and spinning quickly). The final pellet was dispersed by vortexing in S basal then put into 100mM petri dishes (10-15 ml liquid /plate; about 10 ml S basal/0.1 ml eggs). The eggs were hatched in the petri dishes in S basal overnight, with swirling. The L1 larva were spun down and placed on Special NGM plates until they reached the appropriate stage as determined by Nomarski microscopy. They were floated off the plates in water and rinsed three times by spinning at 400g in an IEC clinical centrifuge to remove bacteria. The worm pellets were quick-frozen in liquid nitrogen and stored at -80°C before extraction of the RNA.

Dicer deficient animals were obtained by enriching for dcr-1(ok247) animals from among the progeny of dcr-1(ok247)/qC1 hermaphrodites (6). A recessive ivermectin-resistance marker was incuded in cis to the ok247 allele (A Grishok and C. Mello, personal communication). Gravid hermaphrodites of the above heterozygous genotype were harvested, and eggs were isolated by hypochlorite treatment, as described above. Hatched L1 larvae were placed on paltes with food and 20 ng/ml ivermectin and 1% DMSO. After 4 days of growth, the homozygous dcr-1(ok247) animals were enriched in the population owing to their ivermectin resistance.

RNA extraction

All centrifugation was done in a Sorvall RC5B for 10 minutes at 10K RPM, 4°C, in a SS34 rotor.

Four volumes of Gibco Trizol were added to a frozen pellet of worms and vortexed for 15 minutes. Chloroform was added to 0.85× of the pellet volume, the mixture was vortexed for 1 minute, and centrifuged. The aqueous phase was placed in a clean tube with an equal volume of phenol /chloroform (50/50) and vortexed for 2 minutes, then centrifuged. The aqueous phase was placed in a clean tube and precipitated by addition of one volume of isopropanol and chilling on ice for ten minutes. The RNA precipitate was recovered by centrifugation; the pellet was then rinsed with 70% ethanol/water, air dried, and then dissolved in 0.5ml of TES (10 mM Tris pH 8.0, EDTA 1 mM, 1% SDS). 2 ml Trizol was added and the pellet was vortexed (with heating, if required) until completely dissolved. 425 namel of chloroform was added, the solution was vortexed two minutes then centrifuged. The aqueous phase was removed and placed in a clean tube with an equal volume of phenol/chloroform, vortexed, and centrifuged. The aqueous phase was removed and placed in a clean tube, one-tenth volume of 3M Sodium Acetate was added, followed by one volume of isopropanol. After chilling on ice for an hour, the precipitate was recovered by centrifugation. The pellet was washed with 70% ethanol, air dried and dissolved in 1 ml of TE (10 MM Tris pH 8.0, 1 mM EDTA). Phenol/ chloroform extractions were then repeated until no interface remained after centrifugation. The aqueous phase was then extracted with an equal volume of chloroform, and precipitated by adding one-tenth volume 3M Sodium Acetate, and 3 volumes of ethanol. After spinning, the pellet was rinsed in 70% ethanol, dried and resuspended in TE or water and stored at -80°C.

cDNA library preparation

Total RNA was prepared from mixed-stage populations of C. elegans as described above, and dissolved in denaturing buffer (either 8M urea 20 mM phosphate, pH 6.8, or 70% formamide) at a concentration of approximately 5 mg/ml. Each 200 microliter portion of the RNA sample was centrifuged through a 0.5 ml Centrex 100 column (Schleicher and Schuell) according to the manufacturers instructions. Columns were washed by a second spin with an equal volume of fresh solute, and eluates (enriched for RNAs shorter than approximately 100nt) were pooled. Small RNAs were recovered from this enriched fraction by isopropanol precipitation, followed by electrophoresis through a denaturing 12% acrylamide gel. Material in the 20-25 nt range was excised from the gel and the RNA was eluted with 0.5 M NaAcetate10mM EDTA at room temperature for 12 hours. The eluate was extracted with chloroform to remove gel residue, and the RNA was recovered by ethanol precipitation with 40 micrograms of glycogen, dissolved in 20 microliters of water and stored at -80°C. The small RNA sample was then treated with Calf Alkaline Phosphate (CIP) (New England Biolabs), extracted with phenol/chloroform, and precipitated with ethanol. The CIP-treated RNA was ligated to oligonucleotide "Achimera" (3'p-rA6A24) in 100 microliters of: 50 mM tris pH 7.5, 20 mM MgCl, 3.3 mM DTT, 6 mM ATP, 0.001% BSA, 10% DMSO, 50 U T4 RNA ligase (Amersham) 5°C 12-24 hours. The ligation product (consisting of Achimera ligated to the 3' ends of the sample RNAs; about 50-55 nt), was recovered by size selection using an acrylamide gel as above. This artificially-polyadenylated small RNA sample was used for RT/PCR cDNA synthesis and cloning using the Clontech SMART cloning kit and lambda Triplex2 vector (Clontech). The unamplified version of this library (0501A_Ce22.1) contained about 1.6 × 106 independent clones. The library was amplified (to about 1010 pfu/ml) and stored at -80°C.

DNA sequencing

cDNA clones were sequenced from the unamplified library by two methods: Approximately 200 sequences were obtained by picking individual plaques into10 mM MgCl2, amplifying the insert sequence with Clontech 5´ and 3´ primers, and sequencing using ABI BigDye and a nested primer. The remainder of the sequences were obtained by converting the lambdaTriplex2 phage into pTriplex2 plasmid using the Clonetech instructions, and sequencing plasmid DNA. Plasmid sequencing was performed by Agencourt, Inc of Beverly MA.

Informatics

Approximately 10% of the C. briggsae genome had been analyzed for C. elegans alignment by WJ Kemp and deposited by Kemp on the intronerator Web site [W. J. Kent and A. M. Zahler, Genome Res. 10, 1115 (2000)] http://www.cse.ucsc.edu/~kent/intronerator/. From this sample, 4600 sequences with strong C. briggsae::C. elegans alignments of at least 40 nucleotide were obtained.

C. elegans genomic segments were tested for predicted RNA secondary structure using Michael Zuker's mfold [D. H. Mathews, J. Sabina, M. Zuker, D. H. Turner, J. Mol. Biol. 288, 911 (1999)] Web server http://bioinfo.math.rpi.edu/~mfold/rna/form1.cgi. Each strand was folded individually, in 40-199 nucleotide segments). The output was scanned by eye for stem-loops. The corresponding sequences were tested by BLAST to C. elegans genome and the 40 best stems corresponding to non-repetitive sequences were tested for expression by Northern blots. Probes were radiolabeled oligonucleotides complementary to the 5´ half of the stem (up to the predicted loop) of each of the 40 finalists.

Northern blot analysis.

RNA samples were run on 12% or 15% acrylamide denaturing (urea) gels and then transferred to Zeta-Probe GT membranes by electrophoresis. After transfer, they were crosslinked with 120mjoules of UV and baked at 80°C for 1 hour. Oligonucleotide probes were labeled using Integrated DNA Technologies' Starfire Oligos Kit and Amersham cat #PB10474 alpha-32P ATP and hybridized to the membranes at 42°C in 7% SDS, 0.2M Na2PO4 pH7.0 overnight. Membranes were washed at 42°C, twice with 2×SSPE, 0.1% SDS and twice with 0.5× SSPE, 0.1% SDS. The blots were exposed on Molecular Dynamics Phosphorimager screens and signals were quantified using ImageQuant (Molecular Dynamics).

Oligonucleotide probes: In bold are the probes that detect a ~22 nt transcript.

mir-1_5' ATAGTATGGGCATGTAAGGAAGTATGCAGCTCGG
mir-1_3' CATACTTCTTTACATTCCA
mir-2_5' TGCAACACATCAACCACCGCTTTGATGGCT
mir-2_3' GCACATCAAAGCTGGCTGTGATA
mir-42 GTAGATGTTAACCCGGTGA
mir-43_5' GCCCGTGACATCAAGAAACTAGTGATTATGCC
mir-43_3' ACAGCAAGTAAACTGTGATA
mir-52_5' GCACGGAAACATATGTACGGGTG
mir-52_3' ACCCTTTCATTGTAACGTGATTGAG
mir-58 GCCGTACTGAACGATCTCA
mir-60_5' TTGTCATGATTTTATGGCACTCTTCCAGTTCAAGA
mir-60_3' TCTTGAACTAGAAAATGTGCATAATATCACGTACTTTGTCA
mir-62_5' CGGAAGGATATGAGATCTAACTCAC
mir-62_3' GTAAGCTAGATTACATATCA
mir-72 GCTATGCCAACATCTTGCCT
mir-80_5' ATTGTTCAGAATCATGTCGAAAGCTGAGCGAACGAGTGTCCA
mir-80_3' GCTTTCAACTAATGATCTCA
mir-81 CTGGCTTTCACGATGATCTCA
mir-87_5' GCGAGGTTGAGACGAAAGTATCAGGCG
mir-87_3' CACACCTGAAACTTTGCTCAC
mir-88_5' TTTGTGCGTTCTTCGAATCGACTAGGAAGAGAGATGCTCG
mir-88_3' CGAACATGTTCCTCATCTCCAGTCCCGACGTCAAAGATTCTCGCGTAA
mir-89_5' TGGAAATTGAGTGTTGAGGGAAAAAAGTGAAGAACAAGCACGGAGAC
mir-89_3' GCCACCTTGCTTGCCTTCATCTCATCTCTCAAACACT
mir-90 GGGGCATTCAAACAACATATCA


Supplemental Table B. MicroRNA gene products identified by informatics and cDNA screens in Caenorhabditis elegans.
miRNA
Gene1
Location 2,3Screen4Sequence of ~22 nt transcript5Orthologs6Expression7,8,9Develop10
mir-1T09B4 23047-23029cDNAUGGAAUGUAAAGAAGUAUGC7,8,9 Dm7 Hs7Unif
mir-2M04C9 29592-29570cDNAUAUCACAGCCAGCUUUGAUGUGCC7,8,9 Dm7L1
mir-42ZK930 12488-12506cDNAUCACCGGGUUAACAUCUACC7,9L1
mir-43ZK930 12588-12607cDNAUAUCACAGUUUACUUGCUGU C7,8,9L1
mir-52Y37A1B 60870-60892cDNACACCCGUACAUAUGUUUCCGUGC C7,8,9L1
mir-58Y67D8A 16248-16266cDNAUGAGAUCGUUCAGUACGGCC7,9Unif
mir-60C32D5 16728-16709cDNA/InUAUUAUGCACAUUUUCUAGUC9L1
mir-62T07C5 11866-11885cDNAUGAUAUGUAAUCUAGCUUACC7,8,9L1
mir-72F53G2 2461-2480cDNAAGGCAAGAUGUUGGCAUAGCC7,9L1
mir-80K01F9 996-977cDNAUGAGAUCAUUAGUUGAAAGCC7,8,9Unif
mir-81T07D1 18417-18397cDNAUGAGAUCAUCGUGAAAGCCAGC7,9L1
mir-87F10C2 16008-15989cDNAGUGAGCAAAGUUUCAGGUGUC7,8,9Dm HsL1
mir-88C32E12 650-770InUcUUUgacgUcgggacUggagC9Unif
mir-89C32C4 10732-10756InaacacUcaaUUUccaaUcaaaUaaaC9NT
mir-90K01F9 9712-9691cDNAUGAUAUGUUGUUUGAAUGCCCCC7,9L1
1mir microRNA.
2All these miRNA genes are located between predicted protein coding genes or in introns.
3Basepairs spanned by the ~22 nt transcript (5' to 3') of each miRNA gene within the sequence of the indicated C. elegans genomic clone; see note 5, below.
4The strategy by which the RNA was identfied: from a cDNA library from size selected C. elegans RNAs (cDNA) or by genomic alignment of C. elegans and C. briggsae (In).
5From cDNA sequencing, except for mir-88 and mir-89, for which no cDNAs were found, in which cases a predicted short transcript is inferred from the region of highest C.elegans/C. briggsae homology.
6Predicted by genomic analysis using BLAST (14) and mfold (11,12). Dm, Drosophila melanogaster; Hs, Homo sapiens. C alone indicates that no homologs have been detected outside of Caenorhabditis.
7Expression of the indicated ~22 nt RNA confirmed by northern blot.
8The ~22 nt transcript confirmed to be single-stranded using probes to both ends of the predicted stem.
9Expression of longer predicted stem-loop RNA confirmed by northern blot.
10Stage(s) of C. elegans development (L1-L4) when the transcript(s) appear most abundant. Unif, uniform expression L1-L4 (less than twofold change in level); NT, C. elegans developmental profile not tested.





To Advertise     Find Products


Science. ISSN 0036-8075 (print), 1095-9203 (online)