Identification of Novel Genes Coding for Small Expressed RNAs M. Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl

Supplemental Table 2. Human miRNA sequences and genomic location. From 220 short RNAs sequenced, 100 (45%) corresponded to miRNAs, 53 (24%) to already characterized functional RNAs (rRNA, snRNAs, tRNAs), and 67 (30%) sequences with no database entry. For legend, see Table 1.
miRNA	sequence (5´ to 3´)	chr. or EST, acc. nb.	remarks*
let-7a	UGAGGUAGUAGGUUGUAUAGUU	9, AC007924, 11, AP001359, 17, AC087784, 22, AL049853	sequences of chr 9 and 17 identical and clustered with let-7f, homologs: C. elegans, AF274345; C. briggsae, AF210771, D. melanogaster, AE003659
let-7b	UGAGGUAGUAGGUUGUGUGGUU	22, AL049853, ESTs, AI382133, AW028822	homologs: mouse, EST AI481799; rat, EST, BE120662
let-7c	UGAGGUAGUAGGUUGUAUGGUU	21, AP001667	Homologs: mouse, EST, AA575575
let-7d	AGAGGUAGUAGGUUGCAUAGU	17, AC087784, 9, AC007924	identical precursor sequences
let-7e	UGAGGUAGGAGGUUGUAUAGU	19, AC018755
let-7f	UGAGGUAGUAGAUUGUAUAGUU	9, AC007924, 17, AC087784, X, AL592046	sequences of chr 9 and 17 identical and clustered with let-7a
miR-15	UAGCAGCACAUAAUGGUUUGUG	13, AC069475	in cluster with mir-16 homolog
miR-16	UAGCAGCACGUAAAUAUUGGCG	13, AC069475	in cluster with mir-15 homolog
miR-17	ACUGCAGUGAAGGCACUUGU	13, AL138714	in cluster with mir-17 to mir-20
miR-18	UAAGGUGCAUCUAGUGCAGAUA	13, AL138714	in cluster with mir-17 to mir-20
miR-19a	UGUGCAAAUCUAUGCAAAACUGA	13, AL138714	in cluster with mir-17 to mir-20
miR-19b	UGUGCAAAUCCAUGCAAAACUGA	13, AL138714, X, AC002407	in cluster with mir-17 to mir-20
miR-20	UAAAGUGCUUAUAGUGCAGGUA	13, AL138714	in cluster with mir-17 to mir-20
miR-21	UAGCUUAUCAGACUGAUGUUGA	17, AC004686, EST, BF326048	homologs: mouse, EST, AA209594
miR-22	AAGCUGCCAGUUGAAGAACUGU	ESTs, AW961681, AA456477, AI752503, BF030303, HS1242049	human ESTs highly similar; homologs: mouse, ESTs, e.g. AA823029; rat, ESTs, e.g. BF543690
miR-23	AUCACAUUGCCAGGGAUUUCC	19, AC020916	homologs: mouse, EST, AW124037;rat, EST, BF402515
miR-24	UGGCUCAGUUCAGCAGGAACAG	9, AF043896, 19, AC020916	homologs: mouse, ESTs, AA111466, AI286629; pig, EST, BE030976
miR-25	CAUUGCACUUGUCUCGGUCUGA	7, AC073842, EST, BE077684	human chr 7 and EST identical; highly similar precursors in mouse ESTs (e.g. AI595464); fish precursor different STS: G46757
miR-26a	UUCAAGUAAUCCAGGAUAGGCU	3, AP000497
miR-26b	UUCAAGUAAUUCAGGAUAGGUU	2, AC021016
miR-27	UUCACAGUGGCUAAGUUCCGCU	19, AC20916	U22C mutation in human genomic sequence
miR-28	AAGGAGCUCACAGUCUAUUGAG	3, AC063932
miR-29	CUAGCACCAUCUGAAAUCGGUU	7, AF017104
miR-30	CUUUCAGUCGGAUGUUUGCAGC	6, AL035467
miR-31	GGCAAGAUGCUGGCAUAGCUG	9, AL353732
miR-32	UAUUGCACAUUACUAAGUUGC	9, AL354797	not detected by Northern blotting
miR-33	GUGCAUUGUAGUUGCAUUG	22, Z99716	not detected by Northern blotting
*If several ESTs were retrieved for one organism in the database, only those with different precursor sequences are listed. precursor structure shown in Fig. 4.

Supplemental Figure 1. Expression of D. melanogaster miRNAs. Northern blots of total RNA isolated from staged populations of D. melanogaster were probed for the indicated miRNAs. The position of 76-nt val-tRNA is also indicated on the blots. 5S rRNA serves as loading control. E, embryo; L, larval stage; P, pupae; A, adult; S2, Schneider-2 cells. It should be pointed out, that S2 cells are polyclonal, derived from an unknown subset of embryonic tissues, and may have also lost some features of their tissue of origin while maintained in culture. miR-3 to miR-6 RNAs were not detectable in S2 cells (data not shown). miR-14 was not detected by Northern blotting and may be very weakly expressed, which is consistent with its cloning frequency. Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes.

Medium version | Full size version

Supplemental Figure 2. Expression of vertebrate miRNAs. Northern blots of total RNA isolated from HeLa cells, mouse kidneys, adult zebrafish, frog ovaries, and S2 cells were probed for the indicated miRNAs. The position of 76-nt val-tRNA is also indicated on the blots. 5S rRNA from the preparations of total RNA from the indicated species is also shown. The gels used for probing of miR-18, miR-19a, miR-30, and miR-31 were not run as far as the other gels (see tRNA marker position). miR-32 and miR-33 were not detected by Northern blotting, which is consistent with their low cloning frequency. Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes.

Medium version | Full size version

Northern blotting. Total RNA isolation was performed by acid guanidinium thiocyanate-phenol-chloroform extraction (P. Chomczynski, N. Sacchi, Anal Biochem 162, 156 (1987)). Northern analysis was performed as described (1), except that the total RNA was resolved on a 15% denaturing polyacrylamide gel, transferred onto Hybond-N+ membrane (Amersham Pharmacia biotech), and the hybridization and wash steps were performed at 50 °C. Oligodeoxynucleotides used as Northern probes were let-7a, 5´ TACTATACAACCTACTACCTCAATTTGCC; let-7d, 5´ ACTATGCAACCTACTACCTCT; let-7e, 5´ ACTATACAACCTCCTACCTCA; D. melanogaster val-tRNA, 5´ TGGTGTTTCCGCCCGGGAA; miR-1, 5´ TGGAATGTAAAGAAGTATGGAG; miR-2b, 5´ GCTCCTCAAAGCTGGCTGTGATA; miR-3, 5´ TGAGACACACTTTGCCCAGTGA; miR-4, 5´ TCAATGGTTGTCTAGCTTTAT; miR-5, 5´ CATATCACAACGATCGTTCCTTT; miR-6, 5´ AAAAAGAACAGCCACTGTGATA; miR-7, 5´ TGGAAGACTAGTGATTTTGTTGT; miR-8, 5´ GACATCTTTACCTGACAGTATTA; miR-9, 5´ TCATACAGCTAGATAACCAAAGA; miR-10, 5´ ACAAATTCGGATCTACAGGGT; miR-11, 5´ GCAAGAACTCAGACTGTGATG; miR-12, 5´ ACCAGTACCTGATGTAATACTCA; miR-13a, 5´ ACTCGTCAAAATGGCTGTGATA; miR-14, 5' TAGGAGAGAGAAAAAGACTGA; miR-15, 5´ TAGCAGCACATAATGGTTTGT; miR-16, 5´ GCCAATATTTACGTGCTGCTA; miR-17, 5´ TACAAGTGCCTTCACTGCAGTA; miR-18, 5´ TATCTGCACTAGATGCACCTTA; miR-19a, 5´ TCAGTTTTGCATAGATTTGCACA; miR-20, 5´ TACCTGCACTATAAGCACTTTA; miR-21, 5´ TCAACATCAGTCTGATAAGCTA; miR-22, 5´ ACAGTTCTTCAACTGGCAGCTT; miR-23, 5´ GGAAATCCCTGGCAATGTGAT; miR-24, 5´ CTGTTCCTGCTGAACTGAGCCA; miR-25, 5´ TCAGACCGAGACAAGTGCAATG; miR-26a, 5´ AGCCTATCCTGGATTACTTGAA; miR-27; 5´ AGCGGAACTTAGCCACTGTGAA; miR-28, 5´ CTCAATAGACTGTGAGCTCCTT; miR-29, 5´ AACCGATTTCAGATGGTGCTAG; miR-30, 5´ GCTGCAAACATCCGACTGAAAG; miR-31, 5´ CAGCTATGCCAGCATCTTGCCT; miR-32, 5' GCAACTTAGTAATGTGCAATA; miR-33, 5' TGCAATGCAACTACAATGCACC. 5S rRNA was detected by ethidium staining of polyacrylamide gels prior to transfer. Blots were stripped by boiling in 0.1% aqueous sodium dodecylsulfate/0.1x SSC (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) for 10 min, and were re-probed up to 4 times until the 21-nt signals became too weak for detection. Finally, blots were probed for val-tRNA as size marker.