Selective Transcription and Modulation of Resting T Cell Activity by Preintegrated HIV DNA Yuntao Wu and Jon W. Marsh

Supplementary Material

T cell purification. Elutriated lymphocytes were obtained from healthy human donors at the Department of Transfusion Medicine, NIH and purified by negative selection using a Dynal T cell isolation kit (Dynal A.S, Oslo, Norway) with a mixture of mouse monoclonal antibodies for human CD14, CD16a, CD16b, CD56, and HLA DR/DP. CD4 T lymphocytes were further purified by a second round of negative selection with mouse monoclonal antibodies for CD8, CD11b, and CD19. Isolated T cells (greater than 95% CD4 positive) were negative for HLA-DR and were less than 0.5% positive for CD25. Purified cells were cultured in RPMI 1604 medium supplemented with 10% heat-inactivated fetal bovine serum (GIBCO BRL, Grand Island, N.Y.), penicillin (50 U/ml), and streptomycin (50 g/ml) for 1 day before infection. Bead activation and IL-2 assays were performed as described (1).

Virus infection. Virus stocks of the HIV-1_NL4-3 and the integrase mutant HIV-1_IN/D116N (kindly provided by A. Engelman, Dana-Farber Cancer Institute) were prepared by transfection of HeLa cells with cloned proviral DNA as described (2). Supernatant was harvested and filtered through a 0.45 m nitrocellulose membrane. Virus titer was measured by infection of the HeLa-CD4-LTR--gal indicator cell line, obtained through the AIDS Research and Reference Program (3). For infection of resting CD4 T cells, equal virion levels of HIV-1_NL4-3and HIV-1_IN/D116Nwere used. CD4 cells were incubated with virus for 3 hours, then pelleted and resuspended into fresh culture medium. Generation of a Nef producing, trans-complementation HeLa cell line for the production of a Nef-negative NL4-3 virus, HIV-1_nef/DS (4), was achieved by transduction of HeLa cells with the nef-expression retroviral vector LnefSN-(NL4-3) as described (5). G418-selected Nef-expressing HeLa cells were transfected with the Nef-negative viral DNA clone pnef/DS. The supernatant was harvested and filtered through a 0.45-m nitrocellulose membrane. For infection of resting CD4 T cells leading to the measurement of p24 production, 1 million cells were infected with equal levels of (4 10⁶ pg of p24) of HIV-1_NL4-3and HIV-1_nef/DS. After stimulation with CD3-CD28 beads, supernatant was taken and levels of p24 were measured by using a Coulter HIV-1 p24 assay kit (Beckman Coulter, Miami, FL).

Quantitative RT-PCR, hybridization, and cloning. Total cellular poly(A⁺) mRNA was purified from infected CD4 T cells by MicroPoly(A)Pure mRNA isolation kit (Ambion, Austin, TX) as recommended by the manufacturer. Reverse transcription was accomplished using the RETROscript First-Strand Synthesis Kit (Ambion) with random decamers as the first-strand primers. After cDNA synthesis, PCR was carried out using different sets of primer pairs and conditions as listed in Table 1. One-fifth of the product was analyzed on 2% agarose gel, transferred onto NYTRAN SPC nylon membrane (Schleicher & Schuell, Keene, NH), and hybridized with digoxigenin labelled probes. Hybridization was carried out at 55°C in QuikHyb buffer, 100 g/ml salmon sperm DNA (Stratagene), 10 pmol/ml probe. After hybridization, blots were incubated with a horseradish peroxidase-labeled sheep antibody for digoxigenin (1:1000 dilution; Boehringer Mannheim, GmbH, Germany). The light signal was captured on a cooled CCD camera using chemiluminescent SuperSignal West Dura substrate (Pierce, Rockford, IN). To determine the DNA sequence of the amplified viral transcripts, RT-PCR products from cells, infected with either HIV-1_NL4-3or HIV-1_IN/D116N, were cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA). Nine clones (two from HIV-1_NL4-3and seven from HIV-1_IN/D116N infected cells) were randomly selected for DNA sequence analysis. Eight of the clones revealed nucleotide sequences corresponding to the nef transcripts that contain three exons with splicing junctions at position 289/5523 and 5591/7925. Nucleotide numbering is as described (6). The remaining clone, from HIV-1_IN/D116Ninfected cells, contained an alternatively spliced nef transcipt, which has been described previously (7). This clone contained four exons with splicing junctions at position 289/4936, 5009/5523 and 5591/7925, respectively.

---

Supplemental Table 1. Experimental specifics for primers, probes, and PCR conditions
Primer	Sequence (5' to 3' )	PCR condition
F1/B1	F1: GGTTAGACCAGATCTGAGCCTG B1: TCTGAAGGGATGGTTGTAGCTGTCC	35 cycles in 1 x Promega PCR buffer, 1.5mM MgCl2, 125 M dNTP. 50 pmol each primer. 94°C-20S, 65°C-30S, 72°C-40S
Alu/L1	Alu: TCCCAGCTACTGGGGAGGCTGAGG L1: AGGCAAGCTTTATTGAGGCTTAAGC	35 cycles in 1 x Promega PCR buffer, 2.5mM MgCl2, 400 M dNTP. 100 pmol each primer. 94°C-30S, 66°C-40S, 72°C-3min.
L2/L3	L2: CTGTGGATCTACCACACACAAGGCTAC L3: GCTGCTTATATGTAGCATCTGAGGGC	35 cycles in 1 x Promega PCR buffer, 1.5mM MgCl2, 125 M dNTP. 50 pmol each primer. 94°C-20S, 65°C-30S, 72°C-40S
F2/B4	F2:TAATCGGCCGAACAGGGACTTGAAAGCGAAAG B4: CCATCGATTGCGTCCCAGAAGTTCCACAATCC	30 cycles in 1x Ambion RT-PCR buffer, 125M dNTPs, 1.5 mM MgCl2, 50 pmol of F2 and B4 primers, 2 pmol -actin primer pair, 18 pmol -actin competitor, 1 U SuperTaq Plus (Ambion Inc. Austin, TX) with 94°C-20S, 45°C-30S, 68°C-40S
F2/B3 F2/B2 F2/B1	B3: CCCATCTCCACAAGTGCTGATACTTC B2: CTAGGTCAGGGTCTACTTGTGTGC B1: TCTGAAGGGATGGTTGTAGCTGTCC	30 cycles in 1x Ambion RT-PCR buffer, 125 M dNTPs, 1.5 mM MgCl2, 50 pmol of each primer, 1 U SuperTaq Plus (Ambion Inc. Austin, TX) with of 20 sec at 94°C, 30 sec at 65°C (F2/B3, F2/B2) or 60°C (F2/B1), 40 sec at 68°C
Probes	P1: digo-GCTGACTTCCTGGATGCTTCCAGG P2: digo-CCTGCCATAGGAGATGCCTAAGGC P3: digo-GAGCTCTTCGTCGCTGTCTCCGCT P4: digo-GTGCTAAGGATCCGTTCACTAATCG * digo- : digoxigenin

---

Nef Western. Immunodetection of Nef protein was performed by resolving proteins on a 4 to 20% SDS-polyacrylamide gel and electroblotting onto a 0.2-m nitrocellulose membrane. A 1:1000 dilution of an anti-Nef sheep antiserum (8) was incubated with the membrane overnight at 4°C, followed by a secondary incubation with a 1:20,000 dilution of rabbit anti-sheep antibody conjugated to peroxidase (Kirkegaard & Perry Laboratories, Gaithersburg, MD) at room temperature for 1 hour. Detection of the immunoreactive product was as described (1).

Detection of integrated HIV-1 DNA. 8E5 cells were obtained through the AIDS Research and Reference Program (9). These cells, which contain one copy of integrated proviral DNA per cell, were serially diluted and mixed with 10⁶ uninfected CEM-50 cells. Nuclear DNA was purified and aliquots equivalent to 1/10 of the DNA were subjected to amplification by Alu-LTR PCR, using the Alu primer and HIV-1 LTR primer L1 as described (10, 11). After Alu-LTR PCR, a second round of PCR was carried out with an aliquot equivalent to 1/500 of the PCR products, using LTR-specific primer pairs, L2 and L3.

---

Supplemental Figure 1. AZT does not inhibit IL-2 synthesis in activated CD4 T cells. Purified CD4 T cells from three healthy donors (the same donors as indicated in Figure 1 and 3D) were cultured for five days in the absence (open bars) or presence of 50 M AZT (hatched bars). After incubation, cells were activated with CD3-CD28 beads and IL-2 was measured as described in Figure 1.

Medium version | Full size version

---

Supplemental Figure 2. AZT eliminates detectable viral transcription in infected resting T cells. To demonstrate that viral transcripts in resting T cells were newly synthesized, we infected cells as described in Fig. 2D legend, but in the continual presence of 50 M AZT. Comparison of the nef transcripts in the presence or absence of AZT was carried out by quantitative RT-PCR using co-amplified -actin transcript as controls. RT-PCR condition was the same as described in Fig. 2D legend.

Medium version | Full size version

---

Supplemental References

1. J. A. Schrager, J. W. Marsh, Proc. Natl. Acad. Sci. U.S.A. 96, 8167 (1999).

2. A. Engelman, G. Englund, J. M. Orenstein, M. A. Martin, R. Craigie, J. Virol. 69, 2729 (1995).

3. J. Kimpton, M. Emerman, J. Virol. 66, 2232 (1992).

4. C. A. Spina, T. J. Kwoh, M. Y. Chowers, J. C. Guatelli, D. D. Richman, J. Exp. Med. 179, 115 (1994).

5. J. V. Garcia, A. D. Miller, Nature 350, 508 (1991).

6. B. Korber et al., Eds. Human Retroviruses and AIDS 1998: A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences (Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM, 1998).

7. D. F. Purcell, M. A. Martin, J. Virol. 67, 6365 (1993).

8. M. W. Pandori et al., J. Virol. 70, 4283. (1996).

9. T. M. Folks et al., J. Exp. Med. 164, 280 (1986).

10. M. Benkirane, P. Corbeau, V. Housset, C. Devaux, EMBO J. 12, 4909 (1993).

11. T. W. Chun et al., Proc. Natl. Acad. Sci. U.S.A. 94, 13193 (1997).