Recent Origin of Plasmodium falciparum from a Single Progenitor Sarah K. Volkman, Alyssa E. Barry, Emily J. Lyons, Kaare M. Nielsen, Susan M. Thomas, Mehee Choi, Seema S. Thakore, Karen P. Day, Dyann F. Wirth, and Daniel L. Hartl

Supplementary Material

Supplemental Figure 1. Examples of genetic polymorphisms observed within P. falciparum. (A) A single nucleotide polymorphism (SNP) (bold underline) is shown within non-repetitive sequence of the aspartyl protease (AP) gene within intron-IV. (B to E) Various microsatellite polymorphisms including, (B) a homopolymer [poly A; from the ribosomal protein L37A (L37A), Intron-II); (C) TA or AT repeats (from the AP gene, Intron-XIII); (D) CATA repeats (from the AP gene, Intron-XIV); or (E) mixed patterns of polymorphism (poly A, TA repeat, and poly A; found within the L37A gene, Intron-I). Note the SNP within a microsatellite repeat of W2 that is indicated by bold underline. (F) A SNP (bold underline) within microsatellite repeats is shown (from the AP gene, Intron-III). (G) Finally, minisatellite repeats (underlined) that are present in multiple copies (within the Ser/Thr Protein Kinase gene, Intron-I) are illustrated.

Medium version | Full size version

---

Supplemental Figure 2. Microsatellite polymorphisms are common within introns. The microsatellite (MS) polymorphisms identified within introns are shown for each isolate (3D7, D6, HB3, W2, 1776, 12.1, 37.4, and 51.1). Indicated are: the chromosome (2 or 3) on which the gene resides; the name of the gene* [1 (RRM-type RNA binding protein); 2 (Acyl Carrier Protein); 3 (Ribosomal Protein L37A); 4 (Ser/Thr Protein Kinase); 5 (WEB-1 ortholog, WD40); 6 (Clathrin Coat Assembly Protein); 7 (Chromatin Binding Protein); 8 (Ubiquitin Conjugating Enzyme); and 9 (Aspartyl Protease)]; the intron number of the gene (I-XIV); and, the number of unique alleles (1-8, shown in colored boxes) for each polymorphic microsatellite in the intron (N, no MS polymorphism). The total number of alleles per polymorphic MS is shown, along with the type of microsatellite polymorphism (MS Poly) type^¶ [A (polyA); B (polyT); C (AT); D (TA); E (minisatellite); or more complex, F (ATTTTTT); G (ATTTT); H (TA/CATA); and I (CATA) repeats]. Single nucleotide polymorphisms (SNPs)^# within MS repeats [a (A->G); b (A->C); and c (T->C)] are shown, along with the number of isolates** with this SNP (1-8).

Medium version | Full size version

---

Supplemental Figure 3. Two SNPs in the D6 aspartyl protease gene are not present in other P. falciparum isolates, and occur in a region of the gene with evidence of alternative splicing. (A) Sequences across Introns X and XI of the aspartyl protease gene are shown for the DNA and RNA treated with DNAse and reverse transcriptase from the D6 isolate before amplification by PCR. A single product (D6 DNA) was identified from the DNA sample, while three products (D6 RT_A, D6 RT_B and D6 RT_C) were identified from the RNA sample treated with reverse transcriptase before PCR. Alignment suggests multiple products are present in the RNA sample across the region containing SNPs, underlined in bold. (B) DNA from a variety of isolates including D10 (PNG), FCB (Columbia), 7G8 (Brazil), Senegal 07 (Senegal), Vietnam (Vietnam), PR145 (Thailand), Cameroon1037 (Cameroon), and six isolates from Zimbabwe (SH 89, SH 26, SH 67, SH 59, SH 43, SH 61) was analyzed for the presence of the SNPs identified in the D6 isolate within Intron XI of aspartyl protease. Alignment of the resulting sequences across this region indicates that none of these isolates contain the two SNPs identified in D6 (underlined and bold).

Medium version | Full size version

---

Materials and Methods

The isolates used for this analysis included: 3D7 (origin unknown); D6 (Sierra Leone); W2 (Southeast Asia); HB3 (Honduras); 1776 (Papua New Guinea (PNG)); Muz12.4 (PNG), Muz37.4 (PNG), and Muz51.1 (PNG). Parasites were maintained in culture for short duration using standard culture techniques and were characterized by microsatellite marker analysis to maintain a standard genotype for each isolate (29). Parasite cultures of mixed stages were harvested for DNA isolation using standard methods

Genomic sequences were identified using the Malaria Genome Project [chromosome 2 (19) from TIGR (www.tigr.org) and chromosome 3 (20) from the Sanger Centre (www.sanger.ac.uk)] and oligonucleotide primers designed to amplify predicted introns from each gene listed in Table 1. Oligonucletide sequences used included: Ribosomal protein L37A intron I were GTGTGCAAACTATTGTTTAG and AGCAAAATGTCAAGAAGAAC; ribosomal protein L37A intron II were GCAACATGCCAAGTATTTATG and CTAATAATCGTTGATTTAGC; chromatin binding protein intron I were CCATATTTCATAATGACAGA and GGCAAACATATAGAAAGAAAAAAG; clathrin coat assembly protein introns I and II were CGGAAAAATATATCGGTCAATATG and CTTCATTTATAACGTCCTC; Ser/Thr protein kinase intron I were CAGAACATTAAATCAAGG and CTCATATTTCTTCAAGGCATA; Ser/Thr protein kinase intron II were AGATAAAGGGGTCAAGGG and CCATATATCCACCTTTGC; ubiquitin conjugating enzyme intron I were AACATGTCAACATTTGCAAG and CTACATATGAATAATATATG; aspartyl protease was amplified in three fragments: fragment I primers included CCTAACAAGTCTAGGACCTT and GCTAATCCTATACATTGATG; fragment II primers included AGTCTACACATACATTCAAG and ATAAAATCCAAGGTAATCTC; fragment III primers included GCTAGCCAATTTACCTATAA and GCTTCAATTAGACCTATGAG; acyl carrier protein primers included CAAAGCAATTATCAGTAGAAGAAGAC and ACTATCAGCCCCCAAATCC; WEB-1 ortholog WD-40 primers included GTTTTGTTCTTTGGTGGCTGTCTG and GGTGGATTCCAGGACAATACTAGC; and for RRM-type RNA binding protein primers included CCACCATCATTTGTAATAACATC and CTTCGTAAGCTTTTATTGCATCC. Standard polymerase chain reaction (PCR) methods were used to amplify the intervening gene sequences, and the product was ligated to a bacterial vector using the TA cloning technique (Invitrogen) before transformation into E. coli.

For each isolate, DNA from each of three independent bacterial clones for each of three independent PCR products were sequenced from both the forward and reverse strands using M13 forward or reverse primers or custom primers and Big-Dye (ABI) chemistry. Custom primers for sequencing ribosomal protein L37A included GCAACATGCCAAGTATTTATG and CTAATAATCGTTGATTTAGC; for chromatin binding proteins included CCTAAAAAGAAGGCGTATGATG and CGTTGTTATTCTCGTCAATAT; and for aspartyl protease included CCTAACAAGTCTAGGACCTT, CTTGAATGTATGTGTAGACT, CATCAATGTATAGGATTAGC, TTATAGGTAAATTGGCTAGC, and AGATTACCTTGGATTTTATG. Raw sequence data were edited and aligned using either Sequencher (GeneCodes) or SeqMan and MegAlign (DNASTAR, Inc). Pair-wise comparisons between isolate consensus sequences and the reference 3D7 strain were used to score polymorphisms.

For reverse transcriptase-polymerase chain reaction (RT-PCR) analysis total RNA was isolated from the D6 isolate by standard methods and subjected to DNAse treatment before reverse transcription (Ambion, according to manufacturers conditions), and the resulting complementary DNA was amplified by the polymerase chain reaction (PCR) as described above for DNA to reveal transcript sequences. Alignment was performed using ClustalW.