|
|
Science 4 May 2001: Vol. 292. no. 5518, pp. 929 - 934 DOI: 10.1126/science.292.5518.929
|
|

|
Integrated Genomic and Proteomic Analyses of a Systematically Perturbed Metabolic Network
T. Ideker, V. Thorsson, J. A. Ranish, R. Christmas, J. Buhler, J. K. Eng, R. Bumgarner, D. R. Goodlett, R. Aebersold, L. Hood
|
Supplementary Material
Supplemental Figure 1.
This file is in Adobe Acrobat PDF format. If you have not installed and configured the Adobe Acrobat Reader on your system, please see Help with Printing for instructions.
Integrated physical-interaction network (PDF format, enlarged from Fig. 4A). Gene expression data from this study are shown in the context of a network of previously observed physical interactions. Nodes represent genes and are labeled with their corresponding gene names. Connections between nodes display physical interactions as recorded in the public databases, where a yellow arrow directed from one node to another represents a protein --> DNA interaction, and a blue line between nodes represents a protein-protein interaction. Global changes in mRNA expression (in this case, in response to a deletion of GAL4 in the presence of galactose) are visually superimposed on the network. The grayscale intensity of each node indicates the change in mRNA expression of the corresponding gene, where medium gray represents no change, darker or lighter shades represent an increase or decrease in expression, respectively (as in Fig. 2), and node diameter scales with the overall magnitude of change. GAL4 is colored in red to signify that its expression level has been perturbed by external means. When viewing this PDF in Acrobat Reader, use the magnifying glass to obtain more detail on network regions of interest and to enlarge the names of individual genes. Highly interconnected groups of genes tend to have common biological function and are annotated accordingly (rectangular labels).
Download supplemental figure 1
Supplemental Figure 2. Comparison of Northern vs. microarray analysis. Total RNA from yeast growing in each of eight perturbation conditions (column headings) was probed with radiolabeled GAL1 or GAL80 cDNA using a Northern blot assay. The actin gene (ACT1) was also labeled as a control expected to be expressed at constant levels over all conditions. Corresponding changes in gene expression measured with the yeast-genome microarray are depicted graphically beneath each blot. Microarray data are shown relative to wt yeast growing in galactose (column 5), with medium-gray representing no change, darker or lighter shades representing increasing or decreasing amounts of expression respectively, and spot size scaling with the magnitude of change. The quantitative log10 change in expression level is annotated in each spot center.

Medium version | Full size version
Supplemental Table 1. mRNA- and protein-expression responses to galactose pathway perturbations (Microsoft Excel format). This table reports mRNA-expression ratios measured across all 23 experimental perturbations (20 initial and three follow-up perturbations) using yeast-genome microarrays, as well as protein-abundance ratios for each of 289 proteins measured between wt+gal and wt-gal conditions using ICAT technology.
To view Supplemental Table 1 in excel format click here
Supplemental Table 2. Physical interactions linking genes with strong expression-profile correlations [accompanies Step (iii) of the text]. Pearson correlations rAB were computed between the expression profiles of pairs of genes A and B, where each profile consists of log10 mRNA-expression ratios over our galactose-pathway perturbations (all 20 except the wt+gal versus wt+gal control). Strong correlations (|rAB| > 0.4) are reported for all cases in which [a] protein A is involved in a known protein DNA interaction with gene B (A B); [b] protein A affects B through a signaling pathway involving a protein-protein interaction between A and a third protein C (A-C B); [c] genes A and B are regulated by protein DNA interactions from a common transcription factor C (C A,B). These interactions are hypothesized to have transmitted expression changes from one gene to another in one or more perturbations. When protein C regulates more than two genes (A, B, ...), we list the range of all pairwise correlations among regulated genes. |
[a] A B |
| A | B | rAB |
| Alpha2 | STE2 | -0.545 |
| BAR1 | -0.469 |
| Cbf1 | PGK1 | -0.574 |
| MET16 | 0.471 |
| Cup2 | CUP1B | 0.631 |
| CUP1A | 0.573 |
| Gcn4 | ARG1 | 0.422 |
| Gcr1 | PGK1 | 0.579 |
| TPI1 | 0.575 |
| CDC19 | 0.544 |
| ENO1 | 0.535 |
| ENO2 | 0.493 |
| Hap1 | CTT1 | -0.45 |
| Hsf1 | SSA4 | -0.409 |
| Mac1 | FRE1 | 0.476 |
| Mcm1 | FAR1 | 0.817 |
| MFA2 | -0.675 |
| MFA1 | -0.526 |
| PIS1 | -0.445 |
| Met28 | MET16 | 0.471 |
| Met4 | MET16 | 0.52 |
| Mig1 | FBP1 | 0.633 |
| HAP4 | 0.601 |
| GAL1 | -0.549 |
| GAL3 | -0.477 |
| GAL10 | -0.465 |
| Msn2 | SUC2 | -0.416 |
| Pdr1 | HXT9 | -0.427 |
| Put3 | PUT1 | 0.535 |
| Rox1 | HEM13 | -0.431 |
| Sip4 | PCK1 | 0.513 |
| FBP1 | 0.5 |
| ICL1 | 0.48 |
| MLS1 | 0.429 |
| Sko1 | SUC2 | 0.433 |
| Ste12 | MFA2 | -0.456 |
[b] A-C B |
| A | C | B | rAB |
| Gcr2 | Gcr1 | TPI1 | -0.859 |
| PGK1 | -0.675 |
| CDC19 | -0.463 |
| ENO2 | -0.443 |
| Hsp42 | Rap1 | PGK1 | 0.529 |
| TPI1 | 0.48 |
| CDC19 | 0.441 |
| Mcm1 | Alpha2 | MFA1 | -0.526 |
| MFA2 | -0.675 |
| Ste12 | MFA1 | -0.526 |
| MFA2 | -0.675 |
| Rad52 | Rfa1 | CAR1 | 0.697 |
| Rfa2 | CAR1 | 0.697 |
| Tpo1 | Cup2 | CUP1A | 0.469 |
| Ydr412W | Pdr1 | HXT9 | -0.451 |
[c] C (A, B, ...) |
| C | (A, B, ...) | rAB |
| Alpha2 | BAR1, MFA1, MFA2, STE2 | 0.427 to .772 |
| Gal11 | GAL1, GAL2, GAL7, GAL10 | 0.807 to 0.919 |
| Gal4 | GAL1, GAL2, GAL7, GAL10, GCY1 | 0.787 to 0.919 |
| Gcn4 | ADE4, HIS3, HIS4, HIS7 | 0.489 to 0.893 |
| Gcr1 | ENO1, ENO2, CDC19, PGK1, TPI1 | 0.563 to 0.891 |
| Hap1 | CYB2, CYC1, CYC7 | 0.388 to 0.753 |
| Hsf1 | HSP26, CUP1 | 0.555 |
| Mcm1 | BAR1, MFA1, MFA2, PIS1, STE2 | 0.427 to 0.854 |
| CLB1, FAR1 | 0.579 |
| Mig1 | GAL1, GAL3, GAL10 | 0.726 to 0.898 |
| FBP1, HAP4 | 0.665 |
| Rap1 | CDC19, ENO1, ENO2, PDC1, PGK1, TPI1 | 0.502 to 0.891 |
| HIS4, RPL16A, RPL18A, RPL18B, RPL25, RPS17A, RPS24A, RPS24B | 0.503 to 0.969 |
| Sip4 | FBP1, ICL1, MLS1, PCK1 | 0.669 to 0.882 |
| Ste12 | MFA1, MFA2, STE2 | 0.679 to 0.772 |
| Supplemental Table 3. Gal4p binding-site predictions [accompanies Step (iii) of the text]. We looked for the well-characterized Gal4p-binding site (UASGAL) upstream of the 997 genes whose mRNA levels were significantly affected by our 20 GAL-pathway perturbations. Of the 41 genes in this set with UASGAL predictions, Gal4p-binding had been confirmed experimentally for seven of these (shown in bold) [R. J. Bram, N. F. Lue, R. D. Kornberg, EMBO J. 5, 603-608 (1986); M. Angermayr, W. Bandlow, J. Biol. Chem. 272, 31630-31635 (1997); W. Zheng, H. E. Xu, S. A. Johnston, J. Biol. Chem. 272, 30350-30355 (1997)]. Since all experimentally-confirmed genes fell into expression clusters 1, 2, or 3, we suggest that other genes in these clusters with predicted UASGAL sites may be directly regulated by Gal4p. Note that the average expression profiles of clusters 1, 2, and 3 are also highly correlated with one another (r12 = 0.8; r13 = 0.8; r13 = 0.7). |
| Cluster | Gene | Upstream position (+/- strand) | Core similarity score | Matrix similarity score | Sequence |
| 1 | GAL1 (GAL10 shares regul. region) | 456 (+) | 1.000 | 0.840 | GTACGGATTAGAAGCCGCCGAGC |
| 437 (+) | 1.000 | 0.880 | GAGCGGGCGACAGCCCTCCGACG |
| 419 (+) | 0.875 | 0.920 | CGACGGAAGACTCTCCTCCGTGC |
| 355 (+) | 1.000 | 0.860 | CCTCGCGCCGCACTGCTCCGAAC |
| 1 | GAL7 | 336 (-) | 1.000 | 0.860 | CCTCGCGCCGCACTGCTCCGAAC |
| 272 (-) | 0.875 | 0.920 | CGACGGAAGACTCTCCTCCGTGC |
| 254 (-) | 1.000 | 0.880 | GAGCGGGCGACAGCCCTCCGACG |
| 2 | GCY1 | 372 (-) | 1.000 | 0.840 | CCCCGGAATAGTCTGCCCCGATT |
| 2 | GAL6 (LAP3) | 67 (+) | 1.000 | 0.870 | CGCCGGCTGACAAGTCGCCGACG |
| 2 | MLF3 | 169 (-) | 1.000 | 0.924 | CCGCGGAGTGCTCTTCGCCGAGA |
| 2 | PCL10 | 235 (-) | 1.000 | 0.848 | GATCGGTGCAATATACTCCGAGC |
| 2 | YEL057C | 417 (+) | 1.000 | 0.828 | GGACGGGCGGCTGCCGTCCGGGG |
| 2 | YPL066W | 101 (+) | 1.000 | 0.827 | TCACGGTCATCACTGCTCCGACA |
| 2 | YPS3 | 211 (+) | 1.000 | 0.876 | GATCGGATTACTATTCGCGGAAA |
| 3 | GAL2 | 533 (-) | 1.000 | 0.905 | TTCCGGAAGGAAGCTTTCCGAAT |
| 419 (+) | 0.800 | 0.829 | CACCGGCGGTCTTTCGTCCGTGC |
| 400 (-) | 0.875 | 0.811 | GAACGGCGCAGATATCTCCGCAC |
| 336 (+) | 1.000 | 0.856 | TATCGGGGCGGATCACTCCGAAC |
| 331 (+) | 0.725 | 0.806 | GGGCGGATCACTCCGAACCGAGA |
| 3 | GAL3 | 291 (-) | 1.000 | 0.818 | GTTCGGCACACAGTGGACCGAAC |
| 3 | GAL80 | 175 (+) | 0.875 | 0.903 | TACCGGCGCACTCTCGCCCGAAC |
| 3 | RPA49 | 249 (+) | 0.800 | 0.825 | GACCGGACACCTAATCACCGACG |
| 3 | YMR318C | 239 (+) | 1.000 | 0.867 | GTCCGGTCCGTCCTTGACCGAAG |
| 3 | YPR194C | 624 (-) | 1.000 | 0.855 | CGTCGGACAGCAACCCCCCGATT |
| 5 | YLR201C | 143 (-) | 1.000 | 0.938 | CTTCCGCCTAATATAGTCCGAAA |
| 7 | ADK1 | 226 (-) | 1.000 | 0.952 | CTGCTGCGGACAGTTCTCCGTGA |
| 7 | RPL27A | 175 (+) | 1.000 | 0.804 | TTGCTGCAGAGATTCGCCCGAAG |
| 7 | RPL34B | 389 (+) | 1.000 | 0.830 | TTTCGGAGGTCCCGCTTCCGACA |
| 7 | YGR090W | 381 (-) | 1.000 | 0.814 | CAACGGCATGCAGCGAGCCGTAG |
| 8 | BAP3 | 750 (+) | 1.000 | 0.812 | GTGCGAAGTAGTATGATCCGAAG |
| 8 | YLR042C | 276 (+) | 0.875 | 0.813 | ATTTGGCCAAGAATGCCCCGAAC |
| 10 | MTH1 | 472 (-) | 1.000 | 0.801 | GCACGGACTCCATTTCCCCGGAC |
| 10 | NAR1 | 460 (-) | 1.000 | 0.823 | CGCCGGCTGACAAGTCGCCGACG |
| 10 | YJL217W | 259 (-) | 1.000 | 0.819 | GAACGGTACTTATTTCCCCGAAA |
| 10 | YLR352W | 298 (-) | 0.875 | 0.819 | GCGCGGGTAACATACCTCCGTGA |
| 11 | ISU1 | 306 (-) | 1.000 | 0.805 | AAGCGGAGATAAAGCCTCCGAAC |
| 12 | MRK1 | 268 (-) | 1.000 | 0.800 | CATCGGACGACTTTGCTCCCAGG |
| 12 | POR1 | 281 (+) | 0.875 | 0.825 | GATCGGGGTTCAATTCCCCGTCG |
| 12 | USV1 | 251 (+) | 0.800 | 0.834 | AACCGTTCAACAGTCTTCCGTAT |
| 12 | YJL112W | 526 (+) | 1.000 | 0.827 | GATCGGGGTTCAATTCCCCGTCG |
| 12 | YMR031C | 305 (-) | 1.000 | 0.840 | TTTTGGGTAACAGCGGACCGAAG |
| 12 | YMR044W | 23 (+) | 0.875 | 0.836 | GAACGGCGTGTCATTCTCCGATA |
| 12 | YMR098C | 299 (+) | 1.000 | 0.853 | AATGGGGTCACAATCATCCGAAC |
| 13 | GAL5 (PGM2) | 337 (-) | 0.725 | 0.828 | CTCCGCGCTTCTCTTCACCGAGC |
| 175 (+) | 0.875 | 0.817 | ATCTGGATGACTGCCGCCCGAAC |
| 14 | MBR1 | 313 (+) | 1.000 | 0.804 | GAGCGGCTCCCCTTTCCCCGGAA |
| 14 | YJL045W | 524 (+) | 0.875 | 0.802 | GATCGGGGTTCAATTCCCCGTCG |
| 14 | YLR164W | 243 (+) | 0.875 | 0.817 | GATTGGAGTACCCTTATCCGAAG |
| 15 | ICL1 | 407 (+) | 1.000 | 0.804 | CCCAGGTTTCCATTCATCCGAGC |
| 16 | YIL057C | 192 (+) | 1.000 | 0.801 | CGGCGGTTGGCAATCGTCCGTAT |
| Supplemental Table 4. New observations, hypotheses, and possible tests |
| OBSERVATIONS | EXAMPLE HYPOTHESES | SYSTEMS-LEVEL TESTS |
| [1] | Effect of gal80D-gal: slow growth and widespread changes in metabolic-gene expression | Stress-related, caused by derepression of either the GAL enzymes or transporter | Examine EP of a gal4Dgal80D-gal double deletion, in which the GAL enzymes and transporter are not expressed |
| [2] | Decrease in GAL-gene expression in response to gal7D+gal or gal10D+gal | Dependent on levels of Gal-1-P or a derivative metabolite | Examine EP of a gal1Dgal10D+gal double deletion strain, in which Gal-1-P levels are reduced |
| [3] | GAL5 and GAL6 mRNA levels are unaffected by galactose addition or by deletion of GAL3, 4, or 80 | Caused by differences in strains and/or media between this and previous studies | Obtain EPs for identical strains and media as in previous studies |
| [4] | GAL6 deletion does not affect mRNA levels of GAL enzymes | | |
| [5] | Expression levels of genes in many other metabolic pathways respond to perturbations of the GAL pathway | Each affected pathway depends on galactose, specific GAL genes, or on the total amount of available energy | Examine EPs of yeast growing in carbon sources other than galactose, e.g. 2% glucose |
| [6] | In wt+gal vs. wt-gal, approx. 15 genes change in protein but not mRNA abundance (Fig. 3) | These genes are regulated at the level of protein translation or degradation | Compare global translation state of proteins between + vs. - gal, using method of [Q. Zong et al. Proc Natl Acad Sci U.S.A. 96, 10632-6. (1999)] |
| [7] | In wt+gal vs. wt-gal, most ribosomal subunits increase in mRNA but not protein abundance (Fig. 3) | | |
| [8] | Nine genes w/ predicted Gal4p-binding sites have EPs that are similar to those of known GAL genes | Gal4p regulates transcription of these genes via protein-DNA interactions | Verify predicted interactions by global chromatin immuno-precipitation experiments [B. Ren et al., Science 290, 2306-9. (2000)] |
Possible model refinements shown in Fig. 1. |
Tests explored in Step (iv) of the paper. |
EP = Expression profile. |
|
|