Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.
Click Me!

Site Tools

  • AAAS
  • Subscribe
  • Feedback

Site Search

Search Advanced

Science 8 December 2000:
Vol. 290. no. 5498, pp. 1975 - 1978
DOI: 10.1126/science.290.5498.1975

Abstract
Full Text
Multigenerational Cortical Inheritance of the Rax2 Protein in Orienting Polarity and Division in Yeast
Tracy Chen, Takatoshi Hiroko, Amitabha Chaudhuri, Fumika Inose, Matthew Lord, Shigeko Tanaka, John Chant, and Atsushi Fujita

Supplementary Material

Methods

Strains, media, growth conditions, genetic methods, and DNA manipulation. Standard methods were used. Yeast strains, plasmids and DNA primers are listed in Tables 1 and 2. All gene deletions were made precisely from the ATG to stop of the open reading frame using the oligonucleotide primers listed in Table 2. All were confirmed by PCR initially and confirmed by PCR in segregants of crosses involving two or more gene deletions.

Identification and characterization of RAX2. To isolate mutations which revert the bipolar budding pattern of the axl1 mutant to random or axial, transposon mutagenesis was used (1). A Tn3-LEU2 transposon mutagenized genomic library were transformed into an axl1::HIS3 ace2 mutant strain (CPY21) exhibiting a bipolar budding pattern. Approximately 40,000 transformants were screened for a difference of colony morphology (2). One mutant, HS42, exhibited an axial or random budding pattern. This mutant was found to have transposon insertion at 299,174 on chromosome XII within the ORF YLR084C. YLR084C was named as RAX2.

Calcoflour staining of bud scars and GFP imaging. Bud scars and birth scars were stained with Calcoflour (3). To observe division scars and Rax2-GFP, cells were lightly patched to the appropriate media. Induction and repression experiments were performed by patching exponentially growing cells from one plate type to another. For staining, cells from the patch were picked by toothpick, swirled in 2 µl of 0.1% Calcoflour on a slide, and pressed relatively hard with a cover slip. Immediate observation by fluorescence microscopy was performed. To view all the GFP patches on the cell surface, focusing up and down during observation was often necessary.

Cell counting method (4). For each strain, at least 100 cells were counted for each category or each time point. Data presented are the summary of the observations of two independent strains. The proximal and distal poles were assigned by locating the birth scar (proximal pole). Bud scars were scored as proximal (p) if they touched or overlapped the birth scar. Bud scars close to the distal pole were scored as distal (d) if they were within a bud scar's radius of the exact pole. Any bud scar that did not touch either pole was scored as medial (m). A three-bud-scar pattern was scored axial (a) if bud scars were connected in a chain emanating from the birth scar. A pattern was scored as bipolar (b) if all the bud scars were at the distal pole, the proximal pole (and did not satisfy axial criteria), or distributed at both poles. A cell was scored as random (r) if one or more scars were in the cell's midsection (not at either pole).

Construction of strains carrying RAX2-GFP. The GFP(S65T)-HIS3M×6 fragment of plasmid pFA6a-GFP(S65T)-HIS3M×6 (5) was amplified with sequences immediately flanking the stop codon of RAX2 using primers pTC17 and pTC18. The amplified DNA was purified and transformed into wild-type strain HAB251-15B. Correct transformants, confirmed by diagnostic PCR, all showed Rax2-GFP signal.

Construction of GAL1-RAX1. RAX1was amplified using primers pTC23 and pTC24. The PCR fragment was cut with Not I, purified, and ligated into the Not I site of pRS316-GAL (E. Bi, University of Pennsylvania Medical School). Constructs of the correct orientation were transformed into a rax1 RAX2-GFP homozygous diploid. Transformants were placed on a glucose plate overnight, then were patched in parallel to a glucose and a galactose plate. After growth, Rax2-GFP signals could be seen on the galactose plate but not on the glucose plate.

Construction of GAL1-RAX2-MYC. A Myc tag was fused to the C-terminus of RAX2 by the same method above, using plasmid pFA6a-13Myc-TRP1, primers pTC17 and pTC18 for PCR. Primers pTC21 and pTC22 were used to amplify the RAX2-Myc fragment with Hind III sites introduced at the fragment ends. This fragment was cut then ligated into the Hind III site of plasmid YEp181-Gal. Constructs were checked for right orientation and transformed into rax2/rax2 strain. Transformants were first grown in glucose-containing medium, then in raffinose-containing medium overnight and induced in galactose media for 2 hours. Myc signal could be detected only in the culture from galactose media, not from glucose or raffinose media.

Construction of GAL1-BUD10-MYC. A Myc tag was fused to the C-terminus of BUD10 using plasmid pFA6a-13Myc-TRP1 as template and primers pTC25 and pTC26. The BUD10-Myc fragment was amplified using primers pTC27 and pTC29 with the addition of Not I site at each end. The PCR product was cut, then ligated into the Not I site of pRS316-GAL. Constructs with the right orientation were transformed into wild-type cells (HAB251-15B). Transformants were turned on under the same condition as used for RAX2-Myc and the signal was detected.

Construction of a BUD8-MYC strain. Plasmid pFA6a-13Myc-TRP1 and primers pTC30 and pTC31 were used to produce a fragment for chromosomal tagging of BUD8. The fragment was transformed into wild-type cells and correct transformants were detected by PCR. All such transformants exhibited a Bud8-Myc signal by immunofluorescence.

Immunofluorescence. Standard indirect immunofluorescence was used to visualize Bud8-Myc. Cells were stained with mouse anti-Myc antibody (Babco) and a secondary CY3-conjugated goat anti-mouse antibody (Jackson Immunologicals). DNA was stained by Hoechst 33342 (Molecular Probes). Samples were observed and photographed by an epifluorescence microscope.

Western blotting. To prepare detergent soluble and insoluble membrane fractions, the following method was used. Cells were grown in glucose containing minimum media until mid-log phase, washed and transferred to raffinose media overnight. Cells were then washed and grown in galactose media for 2 hours. Cells were washed and placed in glucose medium. Samples were collected at the indicated times following this transfer. Cells were pelleted, washed and resuspended in PBS with 1 mM EDTA buffer (Mallinckrodt) containing protease inhibitors and then vortexed with glass beads for five 3-min pulses. The suspension was spun at 4000g for 5 min at 4°C. Supernatant was transferred to Beckman ultracentrifuge tubes prechilled in ice and spun at 65,000g for 20 min at 4°C. The resulting pellet was resuspended in PBS containing 1% Nonidet P-40 (Sigma) and protease inhibitors, dispersed by pipetting up and down, and incubated on ice for 20 min. The suspension was spun at 65,000g for 20 min at 4°C. The resulting supernatant is the detergent soluble membrane fraction, from which protein concentration was measured using Coomassie plus protein assay reagent (Pierce), and the pellet is the detergent insoluble membrane fraction. Samples were boiled with sample buffer for 5 min before loading to a 10% SDS-PAGE gel. Equal volumes of samples were loaded. Immunoblots were performed by standard methods. Mouse monoclonal anti-Myc antibody (Babco) was used at dilution of 1:2000, and the secondary goat anti-mouse HRP antibody (Jackson Immunologicals) was used at the same dilution. Bands were visualized by Supersignal reagent (Pierce).

Northern blotting. Cells were grown under the same condition and samples were collected in the same way as in preparing protein extract. The hot phenol method (6) was used to extract yeast RNA. Standard methods were employed to perform Northern blotting (7). Equal amounts of RNA from each time point were loaded in a 1% agarose/formaldehyde gel. The RNA samples were then transferred to Zeta Probe membrane (Bio-Rad). A 2.6-kb fragment from full-length RAX2 was used as a probe and labeled with [a-32p] using the Prime-a-gene labeling system (Promega). Prehybridization, hybridization, and washing of the membrane were performed according to manufacturer's specifications.

References

1. N. Burns et al., Genes Dev. 8, 1087 (1994).

2. A. Fujita et al., Nature 372, 567 (1994).

3. J. R. Pringle, Methods Enzymol. 194, 732 (1991).

4. J. Chant, J. R. Pringle, J. Cell Biol. 129, 751 (1995).

5. M. S. Longtine et al., Yeast 14, 653 (1998).

6. K. Köhrer, H. Domdey, Methods Enzymol. 194, 398 (1991).

7. J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1994).


Supplemental Figure 1. The effects of rax2 mutations on bud site selection in haploid cells. Scoring was performed exactly as described for Fig. 1B of the report. See Web table 1 for strains used.


Medium version | Full size version


Supplemental Table 1. Yeast strains and plasmids used in this study.
Yeast strainRelevant genotypeSource
SEY6210MATa his3 leu2 lys2 trp1 ura3(Roemer and Bussey, 1991)
HAB251-15BMATa/a his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3*
CPY21MATa axl1D::HIS3 ace2 his3 leu2 trp1 ura3This study
HS42MATa axl1D::HIS3 rax2D::Tn3::LEU2 ace2 his3 leu2 trp1 ura3This study
Y324MATa/a bud1D::TRP1/bud1D::TRP1 his3/his3 leu2/leu2 ura3/ura3(Bender and Pringle, 1989)
TCb81MATa bud8D::HIS3 his3 leu2 lys2 trp1 ura3This study
TCb82MATa bud8D::HIS3 his3 leu2 lys2 trp1 ura3This study
TCb83MATa/a bud8D::HIS3/bud8D::HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TCb81×TCb82
TC313MATa bud8D::HIS3 bud10D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TCb81×TC184
TC323MATa bud8D::HIS3 bud10D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TCb81×TC184
TC362MATa/a bud8D::HIS3/bud8D::HIS3 bud10D::HIS3/bud10D::HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC313×TC323
TC19MATa bud8D::HIS3 rax2D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TCb81×JC1942
TC20MATa bud8D::HIS3 rax2D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TCb81×JC1942
TC398MATa/a bud8D::HIS3/bud8D::HIS3 rax2D::HIS3/rax2D::HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC19×TC20
TC366MATa bud8D::HIS3 bud10D::HIS3 rax2D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TC313×JC1955
TC369MATa bud8D::HIS3 bud10D::HIS3 rax2D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TC313×JC1955
TC380MATa/a bud8D::HIS3/bud8D::HIS3 bud10D::HIS3/bud10D::HIS3 rax2D::HIS3/rax2D::HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC366×TC369
TC459MATa BUD8-MYC-TRP1 his3 leu2 lys2 trp1 ura3This study
TC461MATa BUD8-MYC-TRP1 his3 leu2 lys2 trp1 ura3This study
TC467MATa/a BUD8-MYC-TRP1/BUD8-MYC-TRP1 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC459×TC461
TC184MATa bud10D::HIS3 his3 leu2 lys2 trp1 ura3This study
TC186MATa bud10D::HIS3 his3 leu2 lys2 trp1 ura3This study
TC257MATa/a bud10D::HIS3/bud10D::HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC184×TC186
TC52MATa bud10D::HIS3 rax2D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TC186×1942
TC54MATa bud10D::HIS3 rax2D::HIS3 his3 leu2 lys2 trp1 ura3Segregant from TC186×1942
TC254MATa/a bud10D::HIS3/bud10D::HIS3 rax2D::HIS3/rax2D::HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC52×TC54
TC281MATa rax1D::HIS3 his3 leu2 lys2 trp1 ura3This study
TC268MATa rax1D::HIS3 RAX2-GFP-HIS3 his3 leu2 lys2 trp1 ura3Segregant from TC213×TC281
TC270MATa rax1D::HIS3 RAX2-GFP-HIS3 his3 leu2 lys2 trp1 ura3Segregant from TC213×TC281
TC276MATa/a rax1D::HIS3/rax1D::HIS3 RAX2-GFP-HIS3/RAX2-GFP-HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC268×TC270
JC1942MATa rax2D::HIS3 ade2 his3 leu2 trp1 ura3This study
JC1955MATa rax2D::HIS3 ade2 his3 leu2 trp1 ura3This study
JC1984MATa/a rax2D::HIS3/rax2D::HIS3 ade2/ade2 his3/his3 leu2/leu2 trp1/trp1 ura3/ura3JC1942×JC1955
TC213MATa RAX2-GFP-HIS3 his3 leu2 lys2 trp1 ura3This study
TC215MATa RAX2-GFP-HIS3 his3 leu2 lys2 trp1 ura3This study
TC230MATa/a RAX2-GFP-HIS3/RAX2-GFP-HIS3 his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3TC213×TC215
*SEY6210 auto-diplodized (Roemer and Bussey, 1991).


Supplemental Table 1b.
PlasmidDescriptionSource
pRS303HIS3, YIp vector(Sikorski and Hieter, 1989)
pRS304TRP1, YIp vector(Sikorski and Hieter, 1989)
pRS316-GALpRS316(URA3, centromeric plasmid) with GAL1/10 promoter region cloned in at Eco R1/Bam H1 site(Bi, unpublished)
pGAL-RAX1RAX1 inserted at Not I site of pRS316-GALThis study
pGAL-RAX2-MYCRAX2-MYC inserted at Hind III site of YEp181-GALThis study
pGAL-BUD10-MYCBUD10-MYC inserted at Not I site of pRS316-GALThis study
pFA6a-GFP(S65T)-HIS3M×6C-terminal GFP tag with HIS3 marker(Longtine and Pringle, 1998)
pFA6a-13Myc-TRP1C-terminal MYC tag with TRP1 marker(Longtine and Pringle, 1998)
YEp181-GALLEU2, 2m plasmid. GAL1/10 promoter was cloned in at Eco R1/Bam H1 site, with no ATG provided.(Ptashne, unpublished)


Supplemental Table 2. Primers used in this study.
PurposePrimerTemplate
AXL1 gene deletionpTC1ATAAATGTGCCTGGCGTTAAAAAATAGCAACTGAATAAGTTTTTTTACTGGATTGTACTGAGAGTGCACCpRS304
pTC2GTTGCTTAGATAACAAAAACGTGGAAAGGCTGGAACGAGCAAAATACGGTTGCGGTATTTCACACCGC
DiagnosticpTC3AGTTACTTGATGCGGTATTT
pTC4TCCCATGATTTGCATCAATA
BUD1 gene deletionAM7GGCTTCTATCATCGCTTAGAAATATTTGGCTAGGAAACATTAGGACTACGGATCCCCGGGTTAATTAApFA6A-TRP1
AM8GTCTTTTTATCTGATATCTTGATTCATTTATAATAAAATTAAGTGAGAATTCGAGCTCGTTTAAAC
DiagnosticAM5GCATTCATCCTCGAGATTCTCAAACGCGAA
AM6GAGGTCATCGGTTGAATTCCGGTTGCGTCC
BUD8 gene deletionpTC34CGATTCTACATGAAGTATGATACAATCAGACGAAGATAATTTGGACTCTTGATTGTACTGAGAGTGCACCpRS303
pTC35ATCCTATTTGATGAATGATACAGTTTCTTATTCACGTGTTATACCCACACTGCGGTATTTCACACCGC
DiagnosticpTC36CTTTCTCTTAACTCTAGGAG
pTC37CGGGTACATGTACACAAGT
BUD9 gene deletionpTC38ACAACAATTTCATTCTTCATCCTATGAAATGACGAAAATAACCAGAGATGGATTGTACTGAGAGTGCACCpRS303
pTC39ATTATATAGAGAGTAGCAGGAAATCTTCGACGAGTAAGTCCAGCATGGAGTGCGGTATTTCACACCGC
DiagnosticpTC40CGAAGACAGCATCCAACTTT
pTC41CGAATATGAGCTCTTGGTG
BUD10 gene deletionpTC5ACGATTTCCTGCTTCCAACATCTACGTATATCAAGAAGCATTCACTTACCGATTGTACTGAGAGTGCACCpRS303
pTC6TTAAGCAAAATATCGTTGCGTATAATCACAGCATTTCTGGGATGCGTCCGTGCGGTATTTCACACCGC
DiagnosticpTC7ACACTGCAACAGCCACCATC
pTC8GGGTATCTGTAAACCACTA
RAX1 gene deletionpTC9ACCTCTAACAATTTCTGCCAAAAAGAAAGTTCAAGAGCGTCCCATTCATCGATTGTACTGAGAGTGCACCpRS303
pTC10GTTTCTTGTACTTAGCGTCACGCGCTATGGAAATATGCGGTGCACAGGTGTGCGGTATTTCACACCGC
DiagnosticpTC11CGGGAAATTCATTGTGCACA
pTC12TGCACTTAACGGCCCCTCGC
RAX2 gene deletionpTC13AATACACCTGTTCTTCGTTACGATATAGAAATTAAGATTGTACTGAGAGTGCACCpRS303
pTC14ATATATTATATAATACAACCCCGATTAGACAAACTTGCGGTATTTCACACCGC
DiagnosticpTC15ATATTTATACAGTTGATTGACCGGG
pTC16GATCAACTTAGGATTTTCCTATTTT
Chromosomal RAX2-GFP fusionpTC17CCGCGAATTGATGAGAATGAAATGCTTGATACCGTCCCACCCGAAAAACTTATGAAGTTTGTCCGGATCCCCGGGTTAATTAApFA6a-GFP(S65T)-HIS3M×6
pTC18CTCATTCTCAGGCAGTATTGGTAACATTCCAAGTGACTTCCAATACGTGGAATTCGAGCTCGTTTAAAC
DiagnosticpTC19CCAGAGGGTGATTATAAGCC
pTC20TAAAGGGCTGTAACCCGGAC
pGAL-RAX2-MYC constructpTC21CCCAAGCTTATGTTTGTTCATCGTCTCTGGGenomic DNA of RAX2-MYC-TRP1
pTC22CCCAAGCTTGAATTCACTAGTGATTG
pGAL-RAX1 constructpTC23CCCCGCGGCCGCATGAAGGAAGAGCTCAGCAAGenomic DNA of strain SEY6210
pTC24CCCCGCGGCCGCAATATGCGGTGCACAGGTGT
Chromosomal BUD10-MYC fusionpTC25CAATGTTGGTCAAGTTAAGGACATTCACGGACGCATCCCAGAATGCTGCGGATCCCCGGGTTAATTAApFA6a-13MYC-TRP1
pTC26CAGGAAAATAAAATTAAGCAAAATATCGTTGCGTATAATCGAATTCGAGCTCGTTTAAAC
DiagnosticpTC27CCCCGCGGCCGCTCAAGAAGCATTCACTTACC
pTC28ATAGGGTATCTGTAAACCAC
pGAL-BUD10-MYC constructpTC29CCCCGCGGCCGCGAATTCACTAGTGATTGGenomic DNA of BUD10-MYC-TRP1
Chromosomal BUD8-MYC fusionpTC30CCGGTATTGCTATTGGATTTGGTGTGGGTATAACACGTGAACGGATCCCCGGGTTAATTAApFA6a-13MYC-TRP1
pTC31CAGTTTTTTATTTTTTATCCTATTTGATGAATGATACAGTTTCTTGAATTCGAGCTCGTTTAAAC
DiagnosticpTC32GCCAGCTCGAAGCATACGAC
pTC33CCGCTTAAGGAAGTATCTCG





ADVERTISEMENT
Click Me!

ADVERTISEMENT
Click Me!

To Advertise     Find Products


Science. ISSN 0036-8075 (print), 1095-9203 (online)