Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.


Science 19 January 2001
DOI: 10.1126/science.1057766


Abstract
Full Text
Crystal structure of an initiation factor bound to the 30S ribosomal subunit
Andrew P. Carter, V. Ramakrishnan, William M. Clemons, Ditlev E. Brodersen, Robert J. Morgan-Warren, Brian T. Wimberly

Supplementary Material


To view these movies, download a QuickTime viewer.

  • Animation 1
    Conformational changes in the 16S rRNA of the 30S subunit between the native structure and the IF1-30S complex. The RNA backbone is displayed in ribbons representation, with H44 in cyan. The major changes in the structure are in H44; however, there are also small domain movements, including a tilting of the head toward the body of the subunit.

  • Animation 2
    Conformational changes in the 16S rRNA of the 30S subunit between the native structure and the 30S in the presence of three antibiotics (streptomycin, paromomycin, and spectinomycin). The RNA backbone is displayed in ribbons representation, with H44 in cyan. Movements occur between the shoulder, head, and platform domains. The head tilts back away from the body in the presence of the antibiotics, in contrast to the change observed in the presence of IF1.


Details of Methods

The gene for IF1 was cloned by PCR from Thermus thermophilus genomic DNA. Primers (ATATACATATGGCGAAGGAGAAGGACA and GATGGATCCTTATTACTTGCGGTAAACGATCCG) were designed (using the sequence of the Thermus IF1 gene provided by Dr. Hartsch) so that the PCR product contained a 5´ Nde I site and a 3´ Bam H1 site. The PCR product was inserted into the pET13a vector (1) and expressed in B834 (DE3) cells using standard procedures. For purification all buffers contained 12 mM b-mercaptoethanol, 0.1 mM PMSF, 0.1 mM benzamidine). Induced cells were resuspended in lysis buffer (50 mM Tris pH 6.0, 1 mM EDTA, 1 mM PMSF) and lysed using a lysozyme protocol (2). After removal of cell debris, E. coli proteins were precipitated by adding a volume of boiling lysis buffer to bring the final temperature of the lysate up to ~70°C (3). Filtered lysate was loaded onto a cation exchange column (Fractogel SO3-, Merck). The column was washed in 20 mM Tris HCl, pH 6.8, 1 mM EDTA and IF1 eluted on a 1 M NaCl gradient. Fractions were pooled and dialyzed into 20 mM phosphate buffer pH 6.5 before loading onto a hydroxyapatite column (Biorad macro-prep ceramic hydroxyapatite). IF1 was eluted from the column on a 1 M NaCl gradient, concentrated to 10 mg/ml, and stored in 50% glycerol at -70. Prior to use, IF1 was changed into 10 mM Mg2+, 5 mM Hepes pH 7.5, 50 mM KCl, 10 mM NH4Cl using an Ultrafree concentration device.

30S crystals were prepared as described (4). After equilibration in 26% MPD, crystals were transferred into 26% MPD containing 80 mM IF1 for 24 hours before plunge freezing into liquid nitrogen. Data were collected on beamline ID14-4 at the ESRF in Grenoble, and integrated and scaled using HKL-2000 (5). The refined 3 Å structure of the 30S with the cobalt ions removed was used as a starting model for refinement using CNS (6) as described previously (7).

  1. S. E. Gerchman, V. Graziano, V. Ramakrishnan, Protein Expr. Purif. 5, 242-251 (1994).
  2. J. H. Kycia et al., Biochemistry 34, 6183-6187 (1995).
  3. J. Blank, N. W. Grillenbeck, R. Kreutzer, M. Sprinzl, Protein Expr Purif 6, 637-45 (1995).
  4. B. T. Wimberly et al., Nature 407, 327-39 (2000).
  5. Z. Otwinowski, W. Minor, in Methods in Enzymology C. W. J. Carter, R. M. Sweet, Eds. (Academic Press, New York, 1997), vol. 276, pp. 307-25.
  6. A. T. Brünger et al., Acta Crystallogr D Biol Crystallogr 54, 905-21 (1998).
  7. A. P. Carter et al., Nature 407, 340-8 (2000).


Structural Description of the Interaction of IF1 with the 30S.

IF1 binds in a cleft between the 530 loop and helix 44 (H44) of 16S rRNA and ribosomal protein s12. Contacts with s12 involve the IF1 residues Glu3, Asp61 (which H bonds to Thr42 on S12), and the backbone carbonyl group of Tyr60 (which is within H bonding distance of Val40 on S12). There is also a small hydrophobic interface between the two proteins. IF1 makes multiple contacts with the 530 loop region of RNA including probable salt bridges between the highly conserved Lys2, Lys39, and Arg66 and the phosphate backbone. There are also H bonding interactions to the phosphate group of C519 from both the backbone amide of Gly38 and the side-chain OH group of Tyr35. Met42 is positioned to stack against the base of G530 consistent with the observation that this residue is always hydrophobic.

The interaction of IF1 with H44 leads to the flipping out of the bases of A1492 and A1493. A1492 is not well ordered but appears to bind in a pocket formed by the interface between IF1 and S12. A1493 is well ordered and buried in a pocket on the face of IF1. In both cases conserved arginine residues (R41 and R46 respectively) are in a position to stack against the base and may help stabilize the interaction. The loop of IF1, containing residues 17 to 25, that is inserted into H44 in order to flip out A1492 and A1493 makes hydrogen bonding contacts with the phosphate backbone. The backbone amide group of N19 H bonds with the phosphate of 1494, while the backbone amide of A20 contacts the 2´OH of the ribose of 1493. In addition, the side-chain of the conserved N19 is within H bonding distance of the ribose group of 1491, while the carbonyl group appears to be contacting the 2´OH of the ribose group of 1492.





To Advertise     Find Products


Science. ISSN 0036-8075 (print), 1095-9203 (online)