AGTR2 Mutations in X-Linked Mental Retardation Virginie S. Vervoort, Michael A. Beachem, Penny S. Edwards, Sydney Ladd, Karin E. Miller, Xavier de Mollerat, Katie Clarkson, Barbara DuPont, Charles E. Schwartz, Roger E. Stevenson, Ellen Boyd, and Anand K. Srivastava

Supplementary Material

The DXZ4 locus consists of a major cluster of 50-100 copies of a unique 3.0 kb sequence. The sequence is organized as a hypervariable tandem repeat cluster ranging in size from 150-350 kb, with outlying single copies (1). The PFGE (pulsed-field gel electrophoresis) analysis showed two fragments in patient DF, one fragment corresponding to the maternal allele (approx. copy number 47 +/–5) and a second fragment (approx. copy number 75 +/–5) corresponding to the allele observed in her father (approx. copy number 77 +/–5).

The transcriptional start site of the AGTR2 gene is at 34 bp and 10 bp upstream of a TATA box and a 12 bp sequence element (CTTCTGTTTTTC) located 63 bp upstream of the 3' splice acceptor site in intron 1 have been shown to be required for efficient transcription (2, 3). A “–29 A/G” variant in intron 1 had previously been shown to produce alternatively-spliced transcript, lacking exon 2, in 10 of 13 (77%) individuals with congenital anomalies of the kidney and urinary tract (CAKUT) in one study (4). However, this variant is also present in 42% of the normal population (4). We sequenced the corresponding genomic region of the AGTR2 gene in patient DF and her parents, and identified that patient DF and her mother is homozygous for the “–29 G” allele. It is unlikely, however, that this variation has any effect on transcription of AGTR2, as both parents of patient DF and other unrelated control individuals with “–29 G” allele show normal detectable levels of the AGTR2 transcript.

We have also analyzed the sequence that spans the breakpoint region for the presence of the 12 bp regulator found in the first intron of the AGTR2 gene (2, 3), but no such 12 bp sequence segment was noted within the sequence.

Materials and Methods

1.

BAC and PAC DNAs were isolated using Qiagen Midi-Prep columns and were labeled by incorporation of biotin-11-dUTP (Sigma) or digoxigenin-11-dUTP (Boehringer Mannheim) by nick translation using DNA polymerase I (Life Technologies). Metaphase chromosome spreads were obtained from lympoblastoid cell lines from patients and FISH was performed using standard methods. Chromosome specific labeled centromeric alphoid probes were used for chromosome 7 and X identification. The labeled probes were visualized with FITC-avidin (for Biotin) or rhodamine-labeled anti-digoxigenin and the chromosomes were counterstained with DAPI. Images were examined under a Zeiss Axiphot fluorescent microscope.

2.

Total RNA from Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines or lymphocytes was isolated using Trizol LS (Life Technologies) and first strand synthesis was performed using SuperScript first-strand synthesis system for RT-PCR (Invitrogen). RT-PCR was performed in a 25 l reaction volume containing 10 M of each primer, 250 M of dNTPs, 1X PCR buffer (1.5 mM MgCl₂) and 1 unit of Taq polymerase (Sigma) with 0.02 M of TaqStart^™ Antibody (Clontech). Typical PCR conditions were: initial denaturation at 95°C for 150 s followed by 35-40 cycles of 95°C for 30 s, 60-65°C for 30 s, and 72°C for 30-60 s with a final extension of 5 min. The following gene specific primers were used: PLS3, Forward primer 5'-CTGACCTGCAAGATGCCCTGGTAATC -3'and Reverse primer 5'- TCTTCATTCCCCTGCCCATCAAACAT -3'(624 bp product; annealing temperature touch down from 65 to 60°C); AIP5L1, Forward primer: 5'- CTTCAGCAGGACCAAAAAGAG -3' and Reverse primer 5'- GTCTTATTCAGTAGAGTCTTCC-3' (product size 171 bp; annealing temperature 60°C); AGTR2 ex1/3, Forward primer 5'- ACGTCCCAGCGTCTGAGAG-3'and Reverse primer 5'- CCACAGCGAGGTTGAAGATGTAT -3' (427 bp product; annealing temperature 60°C); AGTR2 ex2/3, Forward primer 5'- TATGATAACTGCTTTAAACTTCAA-3' and Reverse primer 5'- ATGCTTGCCAGGGATTTCTTCT -3' (546 bp product; annealing temperature 60°C); SLC6A14, Forward primer 5'- CTGGGGAGTTGCTTTAG-3'and Reverse primer 5'- TGCTGATTTATTTCCCACTC-3' (682 bp product; annealing temperature 60°C).

3.

Mutation analysis was performed using Incorporation PCR SSCP (IPS) as previously described (5). AGTR2 exon 3 was amplified using primer 3F: 5'-TCAAGGATGTCCTCAGCTCTGTATGTG-3' and primer 3R: 5'-TCTGGTGAGCCTCAAAGCAAGTAGC-3' (1.24 kb product) in a 10 l reaction volume containing 10-20 ng of genomic DNA, 1X PCR buffer (Sigma), 0.125 mM dNTPs, 1 Ci of [-³²P] dCTP (3000 Ci/mmol), 0.50 M of each primer, and 1.0 unit of Taq polymerase with the following PCR conditions: initial denaturation at 95°C for 300 s, followed by 30 s at 95°C, 30s at 61°C , and 60s at 72°C for 30-35 cycles. 5.0 l of the PCR mix was diluted to 10 l with 2X restriction buffer and the PCR product was digested with PvuII and MslI restriction enzymes simultaneously to produce fragments of sizes, 278, 223, 216, 216, 157 and 150 bp. ³²P-labeled PCR products was denatured for 3 min at 96°C in formamide/NaOH containing loading buffer and analyzed on 0.5X MDE ((BioWhittaker Molecular Applications) gel run at 8 W for 17 h at room temperature. The radioactive signal was visualized using X-Omat film (Eastman Kodak). For large-scale screening, DNA was stored in a 96-well format, with 92 unrelated MR patients and 4 control samples in a single plate. Samples were amplified and analyzed individually. Both strands of PCR products from patients with abnormally migrating bands and a normal control were gel purified and sequenced using an Automated Laser Fluorescence (ALF) DNA sequencer (Amersham Pharmacia Biotech, Piscataway, NJ, USA) using the Thermosequenase Cy^TM5 Dye Terminator kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA) according to the manufacturer’s protocol. Sequence alignment and analyses were accomplished using the DNASTAR program (DNASTAR, Madison WI).

---

Supplemental Figure 1. Genomic region containing the Xq24 chromosome translocation breakpoint region and the AGTR2 gene. Based on public databases, published physical maps and our own additional mapping efforts, we developed a physical map of the Xq24 breakpoint locus (6, 7). Genomic clones (PAC, BAC and YAC) are depicted as horizontal lines. The results of the FISH experiments for each clone where tested are given in brackets (S, spanning; D, distal; P, proximal to the X chromosome breakpoint). Location of clone dA509 that spans the Xq24 breakpoint and the critical breakpoint region (solid red line) are indicated. The sequence of this region of the X chromosome (International Genome Sequencing Consortium) is still fragmentary, containing gaps and represented in several unconnected contigs. We determined the order of sequenced contigs (blue horizontal bars). Vertical gray lines within a contig indicate gaps. Location of markers, genes (in boldface types) and genomic organization of genes are shown. All exons are numbered and open area represent coding region.

Medium version | Full size version

---

Supplemental Figure 2. Automated sequence traces of antisense strand in CMS4954 with nonsyndromic MR showing the T1009C alteration (indicated by an arrow) resulting in an A1009G change in the sense strand. This alteration is predicted to cause a Ileu337Val missense mutation in AGTR2.

Medium version | Full size version

---

Supplemental Figure 3. Amino acid sequence comparison of the human AGTR2 with its counterpart in other mammals. Identities are shown as dots. The human AGTR2 (GenBank accession no. NP_000677) exhibits high homology (91.2-92.6%) to the murine (GenBank accession no. NP_031455) and the rat (GenBank accession no. NP_036626). In rodents 21-22 of 27-29 differences are clustered in the first 45 residues, which correspond to the extracellular, N-terminal domain of the protein. Transmembrane domain (underline), consensus N-glycosylation site (#), protein phosphorylation sites (*), and polymorphic residues (in blue), are marked above the sequence. Amino acids mutated in affected males are shaded. Location of the frame-shift mutation is indicated by an asterisk (red).

Medium version | Full size version

---

Supplemental Figure 4. Expression of the AGTR2 in the human brain. Northern blots (Clonetech) containing RNA from different human adult brain sections were hybridized to a 269 bp probe from the coding region of the AGTR2 gene (upper panel). Northern blot was hybridized with an actin probe (lower panel) to check for equal loading of poly(A)⁺ RNA samples. An approximately 2.8 kb transcript was observed in cerebellum section.

Medium version | Full size version

---

This file is in Adobe Acrobat PDF format. If you have not installed and configured the Adobe Acrobat Reader on your system, please see Help with Printing for instructions.

Download Supplemental Table 1

---

References and Notes

S1. J. Giacalone, J. Friedes, U. Francke, Nature Genet. 1, 137 (1992).

S2. C. Warnecke et al., Biochem J. 340, 17 (1999).

S3. S. Gallinat, S. Busche, M. K. Raizada, C. Sumners, Am. J. Physiol. Endocriol. Metab. 278, 357 (2001).

S4. H. Nishimura, et al., Mol. Cell 3, 1, (1999).

S5. K. Sossey-Alaoui et al., Genomics 60, 330 (1999).

S6. R. Nagaraja et al., Genomics 52, 247 (1998).

S7. H. E. Steingruber et al., Genome Res. 9, 751 (1999).