Contribution of Receptor Editing to the Antibody Repertoire Rafael Casellas, Tien-An Yang Shih, Markus Kleinewietfeld, Jasna Rakonjac, David Nemazee, Klaus Rajewsky, and Michel C. Nussenzweig

Supplementary Material

Supplemental Figure 1. The hCk targeting vector was created from the 7 kb EcoRV-BamHI genomic piece (subcloned into pBluescript SK-) spanning the Jk segments and mCk region. An XbaI restriction site was introduced at the 3´ end of the hCk gene, which was then joined by PCR to the genomic region 3´ of mCk (up to the BamHI) and the 5´ region (up to XhoI) and ligated to the construct as XhoI-BamHI. A neomycin resistance gene (without polyA) flanked by loxP sites was then ligated into the XhoI site. To increase the likelihood of selecting for the right integrated clones, the polymerase II promoter driven diphtheria toxin gene (DTA, Lexicon Genetics) was subcloned 3´ of the targeting construct. XbaI digested DNA from resistant ES colonies was blotted and hybridized with a DNA probe amplified from mouse genomic DNA with the following primers (5´ AATGTTAGTGTCCCTTCCCCCAGTTA and 3´ CAGCTCTTTGTCACATTTGTTTTCTTAT). hCk-targeted ES cell clones could be distinguished from WT by the presence of a new 3 kb band. Mice carrying this mutant allele were crossed to cre recombinase transgenic mice [M. Lakso et al., Proc. Natl. Acad. Sci. U.S.A. 93, 5860 (1996)] to delete the neomycin resistance gene. E, EcoRV; B, BamHI; X, XbaI. WT, wild type genomic; C, construct; M, mutant allele.

Medium version | Full size version

---

Supplemental Figure 2. The aHEL targeting vector was created from the same 7 kb EcoRV-BamHI genomic DNA fragment used to generate the hCk construct. The neoR polyA- gene flanked by LoxP sites was ligated into the SphI-AvrII restriction sites. The Vk22-33 promoter was then joined by PCR to the HyHEL-10-Jk2 gene [C. C. Goodnow et al., Nature 334, 676 (1988)]. This DNA was ligated 3´ of the neoR gene as PmeI-AvrII. The DTA gene was then subcloned 5´ of the targeting construct. Resistant colonies were screened by Southern blot by hybridizing BglII restricted genomic DNA with a probe amplified from the Jk3-Jk5 genomic region. aHEL-positive ES cell clones showed the presence of a new 5.6 kb band. The neoR gene was deleted by crossing aHEL mice with cre recombinase transgenic animals. BII, BglII; E, EcoRV; B, BamHI; WT, wild type genomic; C, construct; M, mutant allele.

Medium version | Full size version

---

Supplemental Figure 3. Assembly of B1-8^high and B1-8^low heavy chains with VkaHEL light chains. B1-8^high/aHEL, and B1-8^low/aHEL antibodies were transiently expressed in A293 cells in the pRK expression vector. Supernatants were then collected and antibodies purified by protein G affinity column chromatography and analyzed by SDS-PAGE. Numbers represent molecular weights (kDa) of protein standards.

Medium version | Full size version

---

Supplemental Table 1. PCR Analysis of Vk-Jk rearrangements in single cells purified from Igkm/h mouse spleens. Out of 179 samples analyzed, 80 cells showed PCR amplification of at least one Vk-Jk rearrangement and 33 showed two alleles. Of the samples where we could amplify both alleles, 17 showed a Vk-Jk germline configuration, indicating that there were false double producers. We found that 7 of the remaining 16 contained a productive rearrangement on one allele and a non-productive one on the other, while the remaining 9 (27% of the 33) showed two productive rearrangements. Single cell PCR was carried out as follows: 2500-5000 cells, gated on B220+hCk+mCk+, were sorted into 0.5 ml tubes containing 250 ml PBS/1% BSA/0.1% NaN3 and kept on ice. About 103 cells were transferred to a Petri dish. Single cells were picked under a microscope using a micromanipulator and were directly transferred into 0.5 ml microtubes containing 20 ml of 1x PCR-Buffer supplemented with 1 mg/ml rRNA from Escherichia coli. Samples were then frozen on dry ice and stored at -80°C until the PCR reaction was performed.
	Genotype
Number of cells with two amplified k alleles*	Vk-Jk/Germline	Vk-Jk/Vk-Jk
33	17	16
Productive/productive		9
Productive/non-productive		7
*From 179 cells isolated from 3 mice in 3 independent experiments.