Jump to: Page Content, Section Navigation, Site Navigation, Site Search, Account Information, or Site Tools.
|
|
Supplementary MaterialMaterials and Methods Manufacturing of Yeast Intergenic DNA Microarrays A total of 6361 DNA fragments corresponding to all yeast intergenic regions were amplified using the Yeast Intergenic Region Primers (Research Genetics) primer set. The PCR reactions were performed using MJ Research Thermocyclers in 96-well plates. Each reaction contains 0.25 mM of each primer of the primer pair, 20 ng of yeast genomic DNA, 250 mM of each dNTP, 2 mM MgCl2, 1X PCR buffer (Perkin Elmer), and 0.875 units of Taq DNA polymerase (Perkin Elmer), in a final volume of 50 ml. The PCR amplification begins with 2 min denaturation at 95°C, followed by 36 cycles of 30 s at 92°C, 45 s at 52°C, and 2 min at 72°C, with a final extension cycle of 7 min at 72°C. Then, each PCR reaction mix (1 mL of each) was reamplified in a PCR reaction (100 mL) using the universal primers (Life Technologies) with the same reagent concentrations and the thermocycling conditions as follows: 3 min at 94°C, followed by 25 cycles of 30 s at 94°C, 30 s at 60°C, and 1 min at 72°C, with a final extension cycle of 7 min at 72°C. Each PCR product was examined by gel electrophoresis. The PCR products were then precipitated with isopropanol, washed with 70% ethanol, dried overnight, and resuspended in 20 mL of 3X standard saline citrate (SSC) made from 20X SSC (3 M NaCl, 0.3M sodium citrate, pH 7.0). The resuspended DNA was transferred to 384 well plates and printed on GAPS-coated slides (Corning) using a Cartesian robot (Cartesian Technologies). The printed slides were rehydrated, snap-dried, and ultraviolet (UV cross-linked in UV Stratalinker (Stratagene) set at 60 mJ. The slides were then stored under vacuum for at least 2 days before hybridization. Location Analysis The chromatin immunoprecipitation part of the protocol was based on protocols from (1, 2). Preparation of Cells, Cross-linking, Cell Washing and Storing Overnight yeast cultures were used to inoculate fresh medium (50 ml) to a starting OD600 = 0.1 and yeast cells were allowed to grow to OD600 = 0.6 to 1.0. Then formaldehyde (1.4 ml) (37% Formaldehyde stock, final concentration 1%) was added to the culture, and incubation continued for 20 min at room temperature, then overnight at 4°C on a rotating wheel. Cells were harvested by centrifugation on a table top centrifuge, washed 3 times with cold TBS (~40 ml) (20 mM Tris-HCl pH 7.5, 150 mM NaCl). After the last wash, the yeast pellet was resuspended using any remaining TBS and transfered to a 1.5-ml Eppendorf tube. After short spin, the remaining supernatant was removed using a pipette. The cell pellet was then frozen in liquid nitrogen and stored at -80°C, or used for next step. Cell Lysis, Sonication, and Immunoprecipitation Cell pellets were thawed on ice, resuspended in 700 ml of lysis buffer [50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate, 1 mM PMSF, 1 mM Benzamidine, Aprotinin (10 mg/ml), Leupeptin (1 mg/ml), Pepstatin (1 mg/ml)] and transferred to 1.5-ml Eppendorf tubes. Glass beads (0.7 ml) (500 mm in diameter, Sigma) were then added to each tube, and the yeast cells were lysed using a Vibrax-VXR (IKA) at maximum power for 2 hours at 4°C. Cell lysate was collected from each tube by centrifugation, and transferred to a new 1.5-ml tube. The lysate was then sonicated 4 times for 20 s at power 1.5 using a Branson Sonifer 250 (Branson) with the "Hold" and "Constant Power" settings, which resulted in sheared DNA with an average size of 400 base pairs. After a 5 min centrifugation at maximum speed, the supernatant was transferred to another tube on ice (Supernatant = yeast whole cell extract, yWCE). In new tubes, yWCE (500 ml) was mixed with of a suspension (30 ml) of washed magnetic beads pre-bound to antibody to Myc (see "Preparation of Magnetic Beads" below). The mixture was incubated overnight on a rotating platform at 4°C. Bead Washing, Elution from Beads and Reversal of Cross-Linking The magnetic beads were washed twice with lysis buffer (1 ml), twice with lysis buffer containing an additional 360 mM NaCl (1 ml), twice with wash buffer (1 ml) (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 0.5% NP40, 0.5% sodium deoxycholate, 1 mM EDTA) and once with TE (1 ml) (10 mM Tris, pH 8.0, 1 mM EDTA). After removal of TE by aspiration, the tubes were centrifuged for 3 min at 3000 rpm and any remaining liquid removed with a pipette. The beads were resuspended in elution buffer (50 ml) (50 mM Tris-HCl pH8.0, 10 mM EDTA, 1% SDS) and incubated at 65°C for 10 min with frequent mixing. Then the tube was centrifuged for 30 s at maximum speed and supernatant (30 ml) was transferred to a new tube. TE/SDS (120 ml) (10 mM Tris HCl pH 8.0, 1 mM EDTA, 1% SDS) was added in order to reverse the cross-linking reaction. In a separate tube, TE/SDS (95 ml) was mixed with yWCE (5 ml) (prepare one yWCE for each IP). The tubes were incubated overnight at 65°C in an incubator to reverse cross-linking. DNA Precipitation After overnight incubation, proteinase K solution (150 ml) (0.4 mg/ml glycogen, 1 mg/ml proteinase K, in TE) was added to each sample. The tubes were incubated for 2 hours at 37°C in the warm room, followed by extraction with 1 volume of phenol (Sigma) twice, and extraction with 1 volume of chloroform/isoamyl alcohol (25:1) once. The DNA was then ethanol precipitated and resuspended in TE (30 ml) containing RnaseA (10 mg) (Sigma). The mixture was incubated for 1 hour at 37°C in the warm room, and purified using Qiagen PCR purification kit. The DNA was eluted with 10 mM Tris pH 8.0 (50 ml). The DNA was then stored at -20°C or placed on ice and used for the next step. Blunting DNA and Ligation of Blunt DNA to Linker The DNA (10 ml) was stored at -20°C for gene specific PCR analysis (conventional Chromatin IP). The remaining immunoprecipitated DNA was diluted to a final volume of 100 ml with ddH20 (usually 40 ml precipitated DNA plus 60 ml water). A control reaction was also assembled by mixing 1 ml of DNA extracted from yWCE with 99 ml of water. The diluted DNA was transferred to PCR tubes and placed on ice. To each of the PCR tubes was added 11 ml 10X T4 DNA polymerase buffer; 0.5 ml BSA (10 mg/ml); 0.5 ml dNTP mix (20 mM each); 0.2 ml T4 DNA polymerase (3U/ml). After the reaction was mixed by pipetting, it was incubated at 12°C for 20 min in a PCR machine. After the incubation, the tubes were placed on ice and 11.5 ml 3M NaOAc; 0.5 ml glycogen (20 mg/ml) was added to each tube. Then, 120 ml of phenol/chloroform/isoamyl alcohol (25:24:1) was added, the tubes were vortexed, and centrifuged 5 min at maximum speed in an Eppendorf centrifuge. The aqueous phase (110 ml) was transferred to a new 1.5-ml Eppendorf tube and 230 ml cold EtOH (100%) was added. After vortexing, the tube was centrifuged for 15 min at 4°C. The supernatant was removed, the pellet washed with 500 ml cold 75% EtOH, and centrifuged again for 5 min at 4°C. The supernatant was removed, and the pellet allowed to air dry briefly. The pellet was resuspended in 25 ml ddH20 and placed on ice. Cold ligase mix (25 ml) [8 ml ddH20; 10 ml 5X ligase buffer; 6.7 ml annealed linkers (15 uM);0.5 ml T4 DNA ligase] was added, mixed, and incubated overnight at 16°C. Ligation-mediated PCR Sodium acetate (6 ml of 3M) (pH 5.2) was added to the linker-ligated DNA. After mixing, 130 ml of cold EtOH was added and the tubes were centrifuged for 15 min at 4°C. The supernatent was removed, and the pellet was washed with 500 ml 75% EtOH, and then centrifuged for 5 min at 4°C. The supernatant was removed, and the pellet was resuspended in 25 ml ddH2O and placed on ice. To the resuspended DNA was added 4 ml 10X ThermoPol reaction buffer; 6.75 ml ddH2O; 2 ml low T mix (5 mM each dATP, dCTP, dGTP; 2 mM dTTP); 1 ml Cy3-dUTP or Cy5-dUTP; 1.25 ml oligo oJW102 (40 uM stock), and the mix was then transferred to PCR tubes. The PCR tubes were placed in PCR machine and were amplified using cycling parameters as follows: First, 2 min at 55°C, followed by addition of 8 ml ddH2O, 1 ml 10X ThermoPol reaction buffer (NEB), 1 ml Taq polymerase (5 U/ml) and 0.01 ml PFU Turbo (2.5 U/ml) to each reaction. Then 5 min at 72°C and 2 min at 95°C. Next, 33 (Cy5) or 35 (Cy3) cycles of 30 s at 95°C, 30 s at 55°C, 1 min at 72°C. After PCR amplification, 5 ml of the reaction mix was run on 1.5% agarose gel to verify the DNA contents. The PCR product should be a smear ranging from 200 to 600 bp with an average size of 400 bp. The remaining PCR product was purified with Qiaquick PCR purification kit and eluted in 50 ml. NaOAc (6 ml of 3M) and 130 ml cold ethanol was added. After mixing, the tubes were centrifuged for 15 min at 4°C. The supernatant was removed, and the pellet washed with 500 ml of 75% ethanol and centrifuged for 5 min at 4°C. Again the supernatant was removed, and the precipitated PCR products were stored at -20°C in a closed box to prevent exposure to light. Pre-hybridization, Probe Preparation, Hybridization and Wash Yeast intergenic slides were incubated in 3.5X SSC, 0.1% SDS, 10 mg/ml BSA for 20 min at room temperature with agitation and then 20 min at 50°C with agitation. The slides were washed with RO water and blown dry with nitrogen. During the slide pre-hybridization step, each target was resuspended in 30 ml of 3X SSC, 0.1% SDS. The Cy5 and Cy3 targets were mixed and 4 ml of tRNA (8 mg/ml) was added. The samples were mixed by vortexing, and then were boiled for 5 min in a heat block. After boiling, the tubes were incubated for 5 min at 50°C and spun briefly. Probe (50 ml)was pipetted onto the slide and covered with a coverslip. Water was added to the reservoirs in the hybridization chamber (Corning). The chambers were assembled and submerged in a 50°C water bath for 20 to 24 hours. The following day, hybridization chambers were disassembled, the coverslips were removed, and the slides were immediately placed in 0.1X SSC and 0.1% SDS at room temperature for 8 min with agitation. The slides were then transferred to 0.1X SSC for 5 min with agitation. This wash was repeated 2 more times. The slides were placed in a rack and dried by centrifugation (Eppendorf centrifuge 5804) for 2 min at 1000 rpm and were immediately scanned or stored in the dark. Scanning The slides were scanned using a GSI Lumonics Scanner (GSI) and the software ScanArray. The Cy3 and Cy5 images were analyzed using ArrayVision5000 software, which defined the grid of spots and quantified the average intensity of each spot and the surrounding background intensity. The background intensity was subtracted from the spot intensity to give the final calculated spot intensity. Single-Array Error Model The Cy3 and Cy5 intensities at each spot on the array were analyzed using a single-array error model first described by (3). This analysis was found to track the uncertainty associated with the low-intensity values and to allow repeated experiments to be averaged with appropriate related weights. According to this error model, the significance of a measured ratio at a spot was defined by a statistic X, which took the form X = (a2 - a1) / [s12 + s22 + f 2 (a12 + a22)]1/2 (1) where a1,2 were the intensities measured in the two channels for each spot, s1 and s22 were the uncertainties due to background subtraction, and f was a fractional multiplicative error that would come from hybridization nonuniformities, fluctuations in the dye incorporation efficiency, scanner gain fluctuations, and so forth. X was approximately normal. The parameters s?and f were chosen such that X had unit variance. The significance of a change of magnitude |x| was then calculated as P = 2(1 - Erf(|X|)) (2) Weighted Average from Triplicate Measurements The method to combine repeated measurements of chromosomal binding was adapted, with modifications, from a method developed by (3). Briefly, the binding ratio was expressed as the log10(a2/a1), where a1,2 were the intensities measured in the two channels for each spot. The uncertainty in the log(Ratio) was defined as s log10(a2/a1) = log10(a2/a1)/X (3) where X was the statistics derived from the single array error model. We used the minimum-variance weighted average to compute the mean log10(a2/a1) of each spot wi = 1/si2 (4) Equation 5.
Medium version | Full size version
Here si was the error of log10(a2/a1) from (3), xi was the i-th measurement of log10(a2/a1), n was the number of repeats.
The error of
Equation 6.
Medium version | Full size version
For the average of multiple slides, the significance statistic X was computed as Equation 7.
Medium version | Full size version
and the confidence was computed using Eq. 2 above.
Gene Assignment The intergenic regions present on the array had to be associated with specific genes in order to perform the analysis. All the intergenic regions were assigned to the gene(s) they are upstream of. In many cases, a single intergenic region contained the promoters of two divergently transcribed genes (e.g., GAL1 and GAL10 or RIO1 and GCY1). In such cases, the intergenic region was assigned to both genes, and the gene expression data were used to "discipline" the location data because it revealed which of the two genes was transcriptionally regulated by the factor. In some cases, an intergenic region was located at the end of two convergently transcribed genes, in which case the intergenic region was not assigned to any gene promoter. Preparation of Magnetic Beads The day before use, 50 ml of beads [Dynabeads M-450 pre-coated with rat antibody to mouse immunoglobulin G-2 (IgG-2] per sample were placed in a 15-ml Falcon tube. The beads were centrifuged for 1 min at 3000 rpm in a tabletop centrifuge. The supernatant was removed and the beads were resuspended in 10 ml PBS containing BSA (5 mg/ml). The beads were washed a second time, then incubated overnight with antibody on a rotating platform at 4°C (1 ml of antibody to Myc 9E11 per 50 ml of beads). After the incubation, the tubes were centrifuged for 1 min at 3000 rpm in a tabletop centrifuge. The supernatant was removed and resuspended in 10 ml PBS containing BSA (5 mg/ml). After a second wash, the beads were resuspended in 30 ml PBS containing BSA (5 mg/ml per sample). Preparation of Unidirectional Linker Tris-HCl (250 ml) (1M), pH 7.9, 375 ml oligo oJW102 (40 uM stock), and 375 ml of oligo oJW103 (40 uM stock) were mixed, and 50-ml aliquots were placed in Eppendorf tubes at 95°C heat block for 5 min. The samples were transferred to a 70°C heater block (with water in the holes) and the block was placed at room temperature and was allowed to cool to 25°C. The block was then transferred to 4°C and allowed to stand overnight. The linkers were stored at -20°C.
oJW102: GCGGTGACCCGGGAGATCTGAATTC Conventional Chromatin IP Chromatin IP experiments were performed as described above and IP-enriched and unenriched DNA (after RNaseA treatment and purification using Qiagen PCR purification kit) were analyzed by sequence-specific quantitative PCR. 1 ml of either IP-enriched DNA or unenriched DNA was amplified in 15-ml reactions containing 5 pmol of each primer; 3.75 mmol of each dATP, dCTP dGTP, and dTTP; 0.7 units of Taq DNA polymerase (Perkin Elmer); and 1 mCi of [?-32P]dUTP for 21 cycles (95°C for 30 s, followed by 50°C for 30 s, and 72°C for 30 s). PCR reactions were then analyzed on 8% polyacrylamide gels. The sequence of the primers used for these experiments is listed below.
GAL2 ACTAATCTCGGTTCGGAGTGA; CAAACTCCAATTAAATGCGG GAL3 TATGTGTTGCAGGCGGTCAAT; AAGATTTCGTGTTCATGCAGA GAL7 TGCTCTGCATAATAATGCCC; TTGCTTTGCCTCTCCTTTTG GAL1/10 GCCAATTTTTCCTCTTCATAACC; TACGCTTAACTGCTCATTGCT GCY1 CAATGGATATGCTTGGGTGA; TTTGCAATCTGCGTGCTAGA GAL80 TGTCTCTGTTTAAATGGCGCA; GGCAAGGACCAGCAGTGATAT FUR4 TTGATTCAGCGCCAATTTGC; GGAATGTCTTCGAACCGAAA MTH1 TTCACTGGAGAAATGGACTCG; ACGATCAGCAAATGGCAGAA PCL10 ATGGGTCCAGCTTTCAGATT; TGTGAAATTCACTCAACATGC GAL4 TAGTGTCTTGCACACCTGCTT; ATTGGGACTTGAACAGCTCCT PGM2 TTTGAACACTAGCCATGCAGG; GCTTCTCTTCACCGAGCCTA ARN1/control GAGAGCTATCGAATGTTTCCTC; TGCACCCATAAAAGCAGGTGT FUS1 TTGTCAGTGATGCCTCAATCCTTC; AGCAACACATACCTTACAAAGCCACTC FAR1 TTGCACTTGCATCACTGTAGGAGC; CTCTAAGACAGAGTGAACAAAAAGG CTT1 GGCTACGTCGAATCCTTACAA; TTATCTCCATTCCGCGTTG Genetic Reagents Both Gal4 and Ste12 were tagged by inserting a sequence coding for 18 Myc epitopes into the normal chromosomal loci of these genes using standard DNA recombination techniques. The vector pWZV88, developed by K. Nasmyth (1), was used as a template to generate specific PCR products for recombination, with pairs of oligonucleotides (ATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAAAGAGtccggttctgctgctag and ATGCACAGTTGAAGTGAACTTGCGGGGTTTTTCAGTATCTACGATTCATTcctcgaggccagaagac for GAL4; TTGAGGTAGATACCAATCGAAGGTCCGATAAAAACCTTCCAGATGCAACCtccggttctgctgctag and CTGGCCCGCATTTTTAATTCTTGTATCATAAATTCAAAAATTATATTATAcctcgaggccagaagac for STE12). The PCR products were transformed into the strain Z1256 to generate strains Z1319 and Z1315. Clones were selected for growth on TRP plates, and the insertion was confirmed by PCR and expression of the epitope-tagged protein was confirmed by Western blotting using an antibody Myc (9E11). For the RT-PCR experiments, the strains Z20 and Z39 were used as GAL4 wild-type and mutant strains, respectively. The strain FY98 was used to measure the genome wide expression profiles in yeast grown in glucose or galactose. Strain List Strain Genotype Z20 MATa, ura3-52, lys2-801, leu2-3, leu2-112, ade2-101, his3^200, GAL+, tyr1-501 Z39 MATa, ura3-52, lys2-801, ade2-101, his3D200, gal4-536, met- Z1256 MATa, ade2-1, trp1-1, can1-100, leu2-3,112, his3-11,15, ura3, GAL+, psi+ Z1315 MATa, ade2-1, trp1-1, can1-100, leu2-3,112, his3-11,15, ura3, GAL+, psi+, STE12::18-Myc-STE12 Z1319 MATa, ade2-1, trp1-1, can1-100, leu2-3,112, his3-11,15, ura3, GAL+, psi+, GAL4::18-Myc-GAL4 FY98 MATa, ura3-52, leu2D1 Expression Analysis Protocol A detailed protocol can be found at http://www.wi.mit.edu/young/expression.html. To measure the genome wide expression profiles in yeast grown in glucose or galactose, cells were grown to an OD 600 of 0.5 to 0.8 in yeast extract peptone (YEP) + Galactose at 30°C and shifted to YPD (YEP + dextrose) for 6 hours. Total RNA and mRNA was isolated and used to produce cDNA and biotin-cRNA, as described previously (4). Five control RNAs were added to equal amounts of total RNA from each preparation. The levels of these control transcripts were then used to normalize each wild type and mutant expression profile to total RNA. Two independent experiments were performed for each wild type versus mutant comparison. Individual mRNA levels were scored if the computer algorithm used for analysis (4) returned a "present" call in both the two wild-type and the two mutant expression profiles for that gene or if the expression levels of that gene changed in the same direction and were greater than background levels in both wild type and mutant comparisons. A decrease was called if an mRNA dropped more than twofold in both comparisons. References 1. M. P. Cosma, T. Tanaka, K. Nasmyth, Cell 97, 299 (1999). 2. A. Hecht, S. Strahl-Bolsinger, M. Grunstein, Nature 383, 92 (1996). 3. C. J. Roberts, B. Nelson, M. J. Marton, R. Stoughton, M. R. Meyer, H. A. Bennett, Y. D. He, H. Dai, W. L. Walker, T. R. Hughes, M. Tyers, C. Boone, S.H. Friend, Science 287, 873 (2000). 4. L. Wodicka, H. Dong, M. Mittmann, M. H. Ho, D. J. Lockhart, Nature Biotechnol. 15, 1359 (1997).
Web Figures The binding of Gal4 to the targets predicted by the genome-wide location method in both glucose and galactose medium was confirmed by conventional chromatin IP (Fig. 2, Web fig. 1). In glucose, the conventional chromatin IP results (Web fig. 1) show that Gal4 binds to the GAL1/10, GAL2, and GAL3 promoters in agreement with the genome-wide location analysis results. In addition, from a longer exposure of the gel (Web fig. 3A) we have quantified the conventional ChIP data for the binding of Gal4 to its target genes GAL2, GAL3, and GAL1/10 in galactose and glucose (summarized in the Web table 1 and Web fig. 3B). We found that the relative difference of Gal4 binding to these genes in glucose and galactose to be less than twofold, in agreement with the genome-wide location results.
Supplemental Figure 1. We have also performed conventional chromatin IP to test Ste12 binding to FUS1 and FAR1, two Ste12 target genes predicted by the genome-wide location analysis (Web fig. 4). We found that Ste12 binds to FUS1 promoter both before and after alpha factor treatment, but to FAR1 promoter only after the treatment, in agreement with the genome-wide location results.
Medium version | Full size version
Supplemental Figure 2. Titration of chromatin IP DNA demonstrates linear PCR amplification. DNA from a myc-Gal4 Chromatin IP (0.25, 0.5, and 1 ml) of were amplified using primers for different Gal4 UASG, and the product is visualized in 8% acrylamide gel.
Medium version | Full size version
Supplemental Figure 3. Quantification of Gal4 binding to GAL2, GAL3, and GAL1/10 in galactose and glucose as measured by conventional ChIP. (A) A chromatin IP experiment was carried out as described in Web fig. 1, and the gel was exposed to a PhosphorImager plate for 24 hours, then was scanned using a BAS2000, PhosphorImager (Fuji). The intensity of all bands was quantified using the "Image GAUGE" software (Fuji) and was listed in Web table 1. After subtracting background, these intensity values were used to calculate the relative enrichment of GAL2, GAL3 and GAL1/10 in galactose, glucose, and an untagged strain. The intensity of the IP DNA (Pellet) was first compared to that of the input, yielding a binding ratio. The binding ratio for each gene was then normalized to the ARN1 control (ARN1 ratio was set to 1). (B) The normalized binding ratios for each gene in the galactose, glucose, and untagged ChIP experiments are displayed. Note that the enrichment of GAL2, GAL3 and GAL1/10 PCR products is only slightly lower in glucose than in galactose, in agreement with the microarray data.
Medium version | Full size version
Supplemental Figure 4. Conventional chromatin IP confirms the binding of Ste12 to its predicted targets, FUS1, and FAR1. Strains with or without a myc-tagged Ste12 protein were grown in YPD and alpha-factor was added. Chromatin IP was performed on cells harvested before and 30 min after alpha-factor treatment. Amplification of FAR1, FUS1 and CTT1 (internal control) is shown for the unenriched DNA (I) and IP-enriched DNA (P). The conventional chromatin IP results demonstrate that Ste12 binds to FUS1 both before and after alpha factor treatment, but binds to FAR1 only after treatment, in agreement with the genome-wide location results.
Medium version | Full size version
Supplemental Table 1. Raw intensities and relative ratios of GAL2, GAL3 and GAL1/10 in chromatin IP experiment. Input, raw intensity of the PCR product from the unenriched DNA ("I" lane in Web fig. 3A); Pellet, raw intensity of the PCR product from the IP-enriched DNA ("P" lane in Web fig. 3A); ratio, a ratio calculated by dividing "Pellet" by "Input"; Norm. ratio, a normalized ratio calculated by dividing the "ratio" for each gene by the "ratio" of the ARN1 control.
Medium version | Full size version
|