Related Content
Search Google Scholar for:
More Information
Related Jobs from ScienceCareers
|
|
Science 20 December 1996: Vol. 274. no. 5295, pp. 2097 - 2100 DOI: 10.1126/science.274.5295.2097
|
|
Reports
Enhancement of Class II-Restricted T cell Responses by
Costimulatory NK Receptors for Class I MHC Proteins
Ofer Mandelboim,
*
Daniel M. Davis,
*
Hugh
T. Reyburn,
*
Mar Valés-Gómez,
Eric
G. Sheu,
Laszlo Pazmany,
Jack L. Strominger
An important feature of the human immune system is the ability of T
cells to respond to small quantities of antigen. Class II major
histocompatibility complex (MHC)-restricted T cells that expressed a
costimulatory natural killer (NK) cell receptor for class I MHC
proteins were cloned. In the presence of low doses of superantigen, the
proliferative response of these T cell clones was three- to ninefold
greater when the T cells were costimulated by way of the NK receptor.
Thus, the action of costimulatory NK receptors on T cells may play a
significant role in initiating and sustaining immune responses.
Department of Molecular and Cellular Biology, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138, USA.
*
These authors contributed equally to this work.
To whom correspondence should be addressed. E-mail:
jlstrom{at}fas.harvard.edu
T cells recognize antigens through contacts
made between the T cell receptor (TCR) and peptides presented in
association with specific MHC proteins on an antigen-presenting cell
(APC). However, the T lymphocyte response is also shaped by many other
interactions between cell-surface molecules on T cells and APCs, as
well as by the action of cytokines (1). Although no distinct
"antigen receptor" analogous to the TCR has been found on NK cells,
NK cell-mediated lysis can be inhibited by NK receptors that also bind
to class I MHC proteins (2, 3). In particular, lysis by NK1
and NK2 cells is inhibited by target cells expressing human leukocyte
antigen (HLA)-Cw2, -Cw4, -Cw5, or -Cw6 and HLA-Cw1, -Cw3, -Cw7, or
-Cw8, respectively (4, 5). Also, lysis by NKB1+
NK3 cells is inhibited by target cells expressing an HLA-B allele containing the Bw4 epitope at residues 77 to 83 (6). Such
inhibition is initiated by the recruitment of protein tyrosine
phosphatases on the cytoplasmic tail of the NK receptor (7).
T cells share with NK cells a common lineage and many phenotypic
markers (8) including NK inhibitory receptors. Indeed,
28% of cytotoxic T cells express p58 NK inhibitory receptors
(9), and the p70 NK inhibitory receptor, NKB1, is expressed
on 0.2 to 15% of T cells (10). The action of these NK
inhibitory receptors can affect T cell function because
NKB1+ T cell clones that can kill superantigen-coated
target cells cannot kill the same target cells transfected with class I
MHC alleles expressing the Bw4 epitope (10).
Recently, an isoform of NK inhibitory receptors was described. These
p50 NK receptors share similar extracellular sequences with the p58
receptors but have altered transmembrane regions, including the
addition of a charged lysine residue, and truncated cytoplasmic tails
(3, 11), so that they lack the YXXL sequences (L, Leu; Y,
Tyr; X, any amino acid) to which protein tyrosine phosphatases can
bind. Such short-tailed NK receptors do not mediate inhibition of NK
cell-mediated lysis but instead activate or coactivate NK clones
(11). To investigate the possible effect of NK activating receptors on T cell function, we studied T cell clones isolated as
by-products in NK cell cloning (12).
Two of these clones, TANK-1 and TANK-9, were prepared from a donor
whose HLA type is HLA-A1, -A2, -B7, -B8, -Cw7, -DR1, -DR17, -DQw2, and
-DQw5. Clone TANK-1 was positive for TCRBV17 (V 17) and
expressed neither NK1, NK2, nor NK3 receptors by flow cytometry (13). Cloning by polymerase chain reaction (PCR) and
sequencing of cDNA derived from TANK-1 (14) revealed the
expression of the short-tailed activating NK receptor, clone 39 (3). Clone TANK-9 was positive for TCRBV2
(V 2) and expressed both NK1 and NK2 receptors by flow
cytometry (13). PCR typing of cDNA derived from TANK-9
(15) revealed that TANK-9 expresses the activating,
short-tailed form of the NK1 receptor (NKAR1) and the inhibitory,
long-tailed form of the NK2 receptor (NKIR2), as well as TCRVA24
(V 24). These T cells with activating NK receptors (TANK
cells) were positive for TCR , CD4, and CD3 and negative for
TCR , CD8, CD16, CD56, and CD94 by flow cytometry (13,
16).
To determine the effect of NK activating receptors on T cell responses,
we examined the proliferative response of TANK-1 and TANK-9 in the
presence of superantigen-coated 721.221 cells, human HLA-DR1+ B cells deficient in cell-surface expression of
class I MHC proteins (17), and 721.221 transfectants
(18). As expected from the TCRVB gene segment expressed by
each clone, TANK-9 responded to toxic shock syndrome toxin 1 (TSST1)
(Fig. 1A) and not to staphylococcal enterotoxin A (SEA)
or SEB (19), whereas TANK-1 responded to SEB (Fig.
1B) and not to SEA (19). At all the tested
concentrations of TSST1, the proliferation of TANK-9 was greater when
the target cell was transfected with either HLA-Cw4 or -Cw6 and reduced
when the target cell was transfected with either HLA-Cw3 or -Cw7 (Fig. 1A).
Fig. 1.
Proliferation of TANK
cell clones in the presence of superantigen is dependent on the class I
MHC allotype of the APC. Proliferation assays were done as described
(18). (A) TANK-9 and (B) TANK-1
were incubated with various concentrations of TSST1 and SEB,
respectively, in the presence of human B cells deficient in
cell-surface expression of class I MHC proteins (721.221) or 721.221 cells transfected with HLA-Cw3, HLA-Cw4, HLA-Cw6, or HLA-Cw7. (C) The proliferation of TANK-1 in response to SEB-coated 721.221 cells (0.5 ng/ml) and the 721.221 transfectants, measured on subsequent days after the initial mixing of
the target and effector cells. In all experiments, each data point was
measured in triplicate. The range in each measurement was less than 5% of the mean of the triplicates. The 721.221 transfectants were generated as in (5). The experiment shown here is
representative of six data sets that were obtained. In the absence of
superantigen, less than 400 cpm were measured regardless of the type of
B cell or T cell present.
[View Larger Versions of these Images (126K GIF file)]
Target cells that enhanced the proliferative response expressed class I
MHC proteins that were recognized by NK1 receptors, whereas target
cells that inhibited the response expressed alleles that were
recognized by NK2 receptors (9, 11). This result implies
that the short-tailed NK1 receptor present on the cell surface of
TANK-9 facilitates the enhancement of the T cell proliferative response, whereas the long-tailed NK2 receptor mediates inhibition of
such a response. The decrease in proliferation of TANK-9 in response to
TSST1 at 50 ng/ml compared to the proliferative response at 0.5 ng/ml
is likely to be due to the induction of anergy (20).
Proliferation of TANK-1 in response to SEB presentation was enhanced by
target cells transfected with either HLA-Cw4 or HLA-Cw7 (Fig.
1B). Two other TANK cell clones behaved similarly
(19). Because the only NK receptor expressed on TANK-1 was
the activating receptor, clone 39, it can be inferred that clone 39 facilitates an enhanced T cell response in the presence of the class I
MHC alleles HLA-Cw4 and HLA-Cw7. These two class I MHC proteins belong to the two distinct groups of HLA-C proteins that are recognized by
either NK1 or NK2 receptors. The molecular basis for the recognition of
both HLA-Cw4 and -Cw7 by clone 39 is unknown, but the sequence of clone
39 is chimeric between NKAR1 and NKAR2.
Fig. 2.
Antibodies to NK receptors on the effector cells or
to class I MHC proteins on the target cells block the alteration in
TANK cell proliferation. (A) Proliferation of TANK-9
stimulated by TSST1 (0.05 ng/ml) was measured in the presence of
721.221 cells and various 721.221 transfectants, with antibodies to the NK1 or NK2 receptors (HO3E4 and GL183, respectively), a control immunoglobulin M (IgM) myeloma protein (TEPC15, Sigma), or a
control IgG1 myeloma protein (MOPC21, Sigma). (B)
Proliferation of TANK-1 stimulated by SEB (0.5 ng/ml) was measured in
the presence of 721.221 cells or 721.221 transfectants plus the
antibody to class I MHC proteins (PA2.6) or an isotype control (MOPC21,
Sigma). To show the largest possible effect of blocking NK receptor
ligation with PA2.6, we harvested the cells 3 days after incubation.
Otherwise, proliferation assays were done as described
(18). Each data point was measured in duplicate.
The range in each measurement was less than 10% of the mean of the
duplicates. The experiments shown here are representative of three data
sets that were obtained.
[View Larger Versions of these Images (69K GIF file)]
The costimulatory effect of HLA-Cw4 or -Cw7 on the proliferative
response of TANK-1 is greatest at lower concentrations of superantigen,
causing a 300 to 900% increase in stimulation compared with
untransfected target cells (Figs. 1, B and C, and 2A). Thus, the
function of costimulatory NK receptors on T cells in vivo might be to
allow a subset of T cells to be particularly responsive to small
quantities of antigen. In addition, the enhanced T cell response of
TANK-1 costimulated by HLA-Cw4 or -Cw7 peaks on the fourth day after
initial stimulation and is maintained for a further 5 days (Fig.
1C). This suggests that the function of the
costimulatory NK receptor on T cells might also be to sustain the
immune response for an extended period. Possible reasons for the sharp
decrease in the proliferation of TANK-1 at about 5 days after initial
stimulation (Fig. 1C) include the up- or
down-regulation of a particular protein on either the T cells or target
cells, depletion of cytokines, or an exhaustion of nutrients within the
media.
To determine directly whether the activating NK receptor on T cells
facilitates the enhancement in proliferation, we used the monoclonal
antibodies (mAbs) HP3E4 and GL183 to NK1 and NK2, respectively, in
assays of TANK-9 proliferation in the presence of TSST1 at 0.05 ng/ml.
Monoclonal antibody HP3E4 blocked the enhancement of TANK-9
proliferation mediated by 721.221 cells transfected with HLA-Cw4 or
-Cw6, and GL183 blocked the inhibition of TANK-9 mediated by HLA-Cw3-
or HLA-Cw7-expressing target cells (Fig. 2A). Analogous
data were obtained with superantigen at 0.5 ng/ml. These data confirm
that the NK1 and NK2 receptors on TANK-9 do indeed mediate the
alterations in the proliferative response to TSST1.
Because none of the available mAbs binds specifically to clone 39, the
role of this molecule in enhancing the proliferative response of TANK-1
could not be directly assessed by antibody blocking. However, the
increase in proliferation of TANK-1 in the presence of SEB at 0.5 ng/ml, mediated by 721.221 cells transfected with HLA-Cw4 or -Cw7, was
blocked by mAb PA2.6 to class I MHC proteins (Fig. 2B).
Analogous data were obtained with SEB at 0.05 ng/ml. These data confirm
that the increased proliferation of TANK-1 is mediated by class I MHC
receptors.
The nonclassical class I MHC protein, HLA-G, has
recently been shown to inhibit both NK1 and NK2 clones (21).
Transfection of HLA-G into 721.221 cells enhanced the proliferation of
TANK-1 in the presence of SEB, compared to untransfected cells (Fig. 3A). In contrast, the carcinoma cell line JEG-3, which
expresses HLA-G but is deficient in class II MHC expression, could not
stimulate TANK-1 in the presence of SEB (Fig. 3A). This
result implies that superantigen cannot be presented by the class I MHC
protein to cause significant proliferation of TANK-1, and that
stimulation must be mediated primarily by superantigen associated with
class II MHC molecules. In support of this conclusion, the
proliferative response of TANK-1 to SEB was diminished in the presence
of mAb LB3.1 to class II MHC (19).
Fig. 3.
Cell-surface
expression of HLA-G on target cells affects the proliferation of TANK
clones. (A) (Top) TANK-1 cells
were incubated with various concentrations of SEB and 721.221 cells,
721.221 cells transfected with HLA-G [1], another 721.221 clone
transfected with HLA-G [2], or the choriocarcinoma cell line JEG-3.
(Bottom) Analysis of the two 721.221 lines transfected with
HLA-G by flow cytometry, with fluorescein isothiocyanate (FITC)-labeled goat antibody to mouse IgG alone (plain line); W6/32,
an antibody to class I MHC proteins, followed by FITC-labeled antibody
to mouse IgG (bold line); or LB3.1, an antibody to class II MHC
proteins, also revealed by FITC-labeled antibody to mouse IgG (dotted
line). One 721.221 line transfected with HLA-G expressed large amounts
of the class I protein on its cell surface [1], whereas the other
HLA-G transfectant did not [2]. (B) Proliferation of
TANK-9 stimulated by various concentrations of TSST1 was measured in
the presence of 721.221 cells, 721.221 cells transfected with HLA-G
[1], or the choriocarcinoma cell line JEG-3. Proliferation assays
were done as described (18). Each data point was measured in duplicate. The range in each measurement was less than 10% of the
mean of the duplicates. The experiments shown here are representative
of three data sets that were obtained.
[View Larger Versions of these Images (83K GIF file)]
SEB-coated 721.221 cells that had been transfected with HLA-G but that
had lost most cell-surface expression of the protein after an extended
period in culture (HLA-G[2]) caused the same extent of TANK cell
proliferation as untransfected cells (Fig. 3A). Thus,
it is the expression of HLA-G that facilitates the enhanced
proliferation of TANK-1, rather than any artefactual alteration in the
phenotype of transfected 721.221 cells. Although HLA-G can facilitate
action through both NK1 and NK2 receptors, HLA-G-transfected 721.221 cells inhibited the proliferative response of TANK-9 to TSST1 (Fig.
3B) (22).
Thus, both NK activating receptors and NK inhibitory receptors are
present on T cell clones, where they can alter the proliferative response of T cells stimulated by superantigen. NK inhibitory receptors
can also inhibit the proliferative response of T cells stimulated by
peptide antigen (19) as well as by superantigen (10), and it is reasonable to infer that NK activating
receptors costimulate T cells activated by peptide antigens. Therefore, distinct combinations of activating and inhibitory receptors on each T
cell could adjust the response of the human immune system to specific
antigens.
Because the presence of an activating NK receptor on a T cell
potentially facilitates a response to small amounts of antigen, it is
possible that TANK cells are important in initiating immune responses.
In particular, because, by flow cytometry, NK receptors occur primarily
on T cells of a memory phenotype (19, 23), costimulatory NK
receptors may especially facilitate the rapid induction of secondary T
cell-mediated immune responses. In addition, the expression and
function of activating class I MHC receptors may allow activation of a
T cell whose TCR may interact weakly with self peptide. Thus,
expression of such receptors could also be significant in triggering
the onset of autoimmune disease.
REFERENCES AND NOTES
-
V. A. Boussiotis,
J. G. Gribben,
G. J. Freeman,
L. M. Nadler,
Curr. Opin. Immunol.
6,
797
(1994)
[Medline].
-
E. Ciccone
et al.,
Proc. Natl. Acad. Sci. U.S.A.
87,
9794
(1990)
[Medline];
E. Ciccone
et al.,
J. Exp. Med.
175,
709
(1992)
[Medline];
V. Litwin
et al.,
ibid.
178,
1321
(1993)
[Medline];
M. Colonna and
J. Samaridis,
Science
268,
405
(1995)
[Medline];
A. D'Andrea
et al.,
J. Immunol.
155,
2306
(1995)
;
J. E. Gumperz and
P. Parham,
Nature
378,
245
(1995)
[Medline];
A. Moretta
et al.,
Annu. Rev. Immunol.
14,
619
(1996)
[Medline].
-
N. Wagtmann
et al.,
Immunity
2,
439
(1995)
[Medline].
-
M. Colonna,
E. G. Brooks,
M. Falco,
G. B. Ferrara,
J. L. Strominger,
Science
260,
1121
(1993)
[Medline];
M. Colonna,
G. Borsellino,
M. Falco,
G. B. Ferrara,
J. L. Strominger,
Proc. Natl. Acad. Sci. U.S.A.
90,
12000
(1993)
[Medline].
-
O. Mandelboim
et al.,
J. Exp. Med.
184,
913
(1996)
.
-
M. Cella et al., ibid.
180, 1235 (1994);
J. E. Gumperz
et al.,
ibid.
181,
1133
(1995)
[Medline].
-
L. Olcese
et al.,
J. Immunol.
156,
4531
(1996)
[Medline];
D. N. Burshtyn
et al.,
Immunity
4,
77
(1996)
[Medline];
A. M. Fry
et al.,
J. Exp. Med.
184,
295
(1996)
[Medline]; K. S. Campbell et
al., ibid., p. 93.
-
H. Spits,
L. L. Lanier,
J. H. Phillips,
Blood
85,
10
(1995)
.
-
M. C. Mingari
et al.,
Int. Immunol.
7,
697
(1995)
[Medline];
C. S. Falk,
A. Steinle,
D. J. Schendel,
J. Exp. Med.
182,
1005
(1995)
[Medline];
S. Ferrini
et al.,
Eur. J. Immunol.
24,
2294
(1994)
[Medline];
H. Nakajima,
H. Tomiyama,
M. Takiguchi,
J. Immunol.
155,
4139
(1995)
[Medline].
-
J. H. Phillips,
J. E. Gumperz,
P. Parham,
L. L. Lanier,
Science
268,
403
(1995)
[Medline].
-
A. Moretta
et al.,
J. Exp. Med.
182,
875
(1995)
[Medline];
R. Biassoni
et al.,
ibid.
184,
645
(1996)
.
-
TANK cell clones were prepared in the same manner as the NK
clones used in (5), except that the CD4+ T
cells were not depleted.
-
Cells were typed by flow cytometry for the presence of CD3,
CD4, CD8, CD16, CD56, TCR
 , and TCR (with antibodies from
Becton-Dickinson), the type of TCR (with antibodies from Coulter
Immunology), CD94 (with mAb HP3B1), and NK receptors [with mAbs
specific for NK1 receptor (HP3E4), NK2 receptor (GL183, Coulter
Immunology), and NK3 receptor (DX9)].
-
Oligonucleotides complementary to nonpolymorphic
regions of the known NK receptor sequences were chosen as
GATGGTACATGTCATAGGAGCTCC (at the 3
end) and
GAAAACCTTCCCTCCTGGCCC (at the 5 end). The
resultant PCR product that was amplified from cDNA derived from the T
cell was cloned into pCRII (Invitrogen). The sequence of the insert was
determined by automated sequencing at the Molecular Biology Core
Facilities at the Dana-Farber Cancer Institute, Boston, MA. This
sequence was then aligned against sequences currently held in the
GenBank database with the program BLAST. The insert obtained from the
cDNA of clone TANK-1 was 100% identical to that of the NK receptor,
clone 39.
-
Reverse transcriptase-PCR typing of NK receptors was
performed with oligonucleotides complementary to polymorphic regions of
the extracellular portions of the known NK receptors and with
oligonucleotides complementary to the long and short cytoplasmic tail
sequences of NK receptors (H. T. Reyburn et al., in
preparation).
-
TANK cells are not exclusively CD4+
TCR
 + because TCR + and
CD8+ TCR + TANK cells have also been
obtained (O. Mandelboim et al., in preparation).
-
Y. Shimizu and R. DeMars, J. Immunol.
142, 3320 (1989).
-
Proliferation assays were performed as follows: The target
cells were irradiated on a cesium source for 30 min (
30 Gy).
Thereafter, 50,000 T cells, 25,000 target cells, various amounts of
superantigen, and any other appropriate reagents were mixed in a total
volume of 200 µl of RPMI-10% fetal calf serum in each well of a
96-well plate. After incubation at 37°C and 5% CO2 for 2 days (or the time indicated), 1 µCi of [3H]thymidine
was added to each well, and the cells were further incubated at 37°C
overnight. The cells were then harvested (Harvester 96 Mach III M,
Tomtec) and counted on a liquid scintillation counter (1450 Microbeta
Plus, Wallac). In analysis of the counts per minute (cpm) from each
well, the background cpm from a well in which identical reagents and
target cells were placed in the absence of any T cells was subtracted.
-
O. Mandelboim, D. M. Davis, H. T. Reyburn, E. G. Sheu,
unpublished data.
-
J. F. A. P. Miller and
G. Morahan,
Annu. Rev. Immunol.
10,
51
(1992)
.
-
L. Pazmany
et al.,
Science
274,
792
(1996)
[Medline].
-
This may be because HLA-G has a greater binding affinity for
NK2 than for NK1 receptors or because HLA-G can interact with other
inhibitory receptors on lymphocytes yet to be determined.
Alternatively, the signals for inhibition of the proliferative response
could be dominant over activating signals when both are triggered in
this clone.
-
A. D'Andrea,
J. Exp. Med.
194,
784
(1996)
.
-
We thank M. Lopéz-Botet (mAbs HP3B1 and HP3E4) and L. Lanier (mAb DX9). Supported by EMBO and the Fullbright Commission
(O.M.), The Wellcome Trust (H.T.R.), the Arthritis Foundation (L.P.),
and NIH grant CA 47554.
3 July 1996; accepted 12 November
1996
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES:
- Ly49D Engagement on T Lymphocytes Induces TCR-Independent Activation and CD8 Effector Functions That Control Tumor Growth.
- E. Merck, R. B. Voyle, and H. R. MacDonald (2009)
J. Immunol.
182, 183-192
| Abstract »
| Full Text »
| PDF »
- Human Cytomegalovirus Infection Induces a Rapid and Sustained Change in the Expression of NK Cell Receptors on CD8+ T Cells.
- A. van Stijn, A. T. Rowshani, S. L. Yong, F. Baas, E. Roosnek, I. J. M. ten Berge, and R. A. W. van Lier (2008)
J. Immunol.
180, 4550-4560
| Abstract »
| Full Text »
| PDF »
- Patients with paroxysmal nocturnal hemoglobinuria have a high frequency of peripheral-blood T cells expressing activating isoforms of inhibiting superfamily receptors.
- A. Poggi, S. Negrini, M. R. Zocchi, A.-M. Massaro, L. Garbarino, S. Lastraioli, L. Gargiulo, L. Luzzatto, and R. Notaro (2005)
Blood
106, 2399-2408
| Abstract »
| Full Text »
| PDF »
- Distinct Transcriptional Control Mechanisms of Killer Immunoglobulin-like Receptors in Natural Killer (NK) and in T Cells.
- J. Xu, A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy (2005)
J. Biol. Chem.
280, 24277-24285
| Abstract »
| Full Text »
| PDF »
- Crystal structure of HLA-G: A nonclassical MHC class I molecule expressed at the fetal-maternal interface.
- C. S. Clements, L. Kjer-Nielsen, L. Kostenko, H. L. Hoare, M. A. Dunstone, E. Moses, K. Freed, A. G. Brooks, J. Rossjohn, and J. McCluskey (2005)
PNAS
102, 3360-3365
| Abstract »
| Full Text »
| PDF »
- Phenotypic and Functional Characterization of CD4 T Cells Expressing Killer Ig-Like Receptors.
- J. van Bergen, A. Thompson, A. van der Slik, T. H. M. Ottenhoff, J. Gussekloo, and F. Koning (2004)
J. Immunol.
173, 6719-6726
| Abstract »
| Full Text »
| PDF »
- KIR in Type 1 Diabetes: Disparate Distribution of Activating and Inhibitory Natural Killer Cell Receptors in Patients Versus HLA-Matched Control Subjects.
- A. R. van der Slik, B. P.C. Koeleman, W. Verduijn, G. J. Bruining, B. O. Roep, and M. J. Giphart (2003)
Diabetes
52, 2639-2642
| Abstract »
| Full Text »
| PDF »
- Selective Activation of the c-Jun NH2-terminal Protein Kinase Signaling Pathway by Stimulatory KIR in the Absence of KARAP/DAP12 in CD4+ T Cells.
- M. R. Snyder, M. Lucas, E. Vivier, C. M. Weyand, and J. J. Goronzy (2003)
J. Exp. Med.
197, 437-449
| Abstract »
| Full Text »
| PDF »
- Soluble HLA class I induces NK cell apoptosis upon the engagement of killer-activating HLA class I receptors through FasL-Fas interaction.
- G. M. Spaggiari, P. Contini, A. Dondero, R. Carosio, F. Puppo, F. Indiveri, M. R. Zocchi, and A. Poggi (2002)
Blood
100, 4098-4107
| Abstract »
| Full Text »
| PDF »
- The lymphoproliferative defect in CTLA-4-deficient mice is ameliorated by an inhibitory NK cell receptor.
- C. A. Chambers, J. Kang, Y. Wu, W. Held, D. H. Raulet, and J. P. Allison (2002)
Blood
99, 4509-4516
| Abstract »
| Full Text »
| PDF »
- Cutting Edge: NKG2D Receptors Induced by IL-15 Costimulate CD28-Negative Effector CTL in the Tissue Microenvironment.
- A. I. Roberts, L. Lee, E. Schwarz, V. Groh, T. Spies, E. C. Ebert, and B. Jabri (2001)
J. Immunol.
167, 5527-5530
| Abstract »
| Full Text »
| PDF »
- Cutting Edge: Leukocyte Receptor Complex-Encoded Immunomodulatory Receptors Show Differing Specificity for Alternative HLA-B27 Structures.
- R. L. Allen, T. Raine, A. Haude, J. Trowsdale, and M. J. Wilson (2001)
J. Immunol.
167, 5543-5547
| Abstract »
| Full Text »
| PDF »
- Recognition of HLA-Cw4 but Not HLA-Cw6 by the NK Cell Receptor Killer Cell Ig-Like Receptor Two-Domain Short Tail Number 4.
- G. Katz, G. Markel, S.'a. Mizrahi, T. I. Arnon, and O. Mandelboim (2001)
J. Immunol.
166, 7260-7267
| Abstract »
| Full Text »
| PDF »
- Major Histocompatibility Complex Class I-Recognizing Receptors Are Disease Risk Genes in Rheumatoid Arthritis.
- J.-H. Yen, B. E. Moore, T. Nakajima, D. Scholl, D. J. Schaid, C. M. Weyand, and J. J. Goronzy (2001)
J. Exp. Med.
193, 1159-1168
| Abstract »
| Full Text »
| PDF »
- Killer Cell Activating Receptors Function as Costimulatory Molecules on CD4+CD28null T Cells Clonally Expanded in Rheumatoid Arthritis.
- T. Namekawa, M. R. Snyder, J.-H. Yen, B. E. Goehring, P. J. Leibson, C. M. Weyand, and J. J. Goronzy (2000)
J. Immunol.
165, 1138-1145
| Abstract »
| Full Text »
| PDF »
- Nonstochastic Coexpression of Activation Receptors on Murine Natural Killer Cells.
- H. R.C. Smith, H. H. Chuang, L. L. Wang, M. Salcedo, J. W. Heusel, and W. M. Yokoyama (2000)
J. Exp. Med.
191, 1341-1354
| Abstract »
| Full Text »
| PDF »
- The Transmembrane Sequence of Human Histocompatibility Leukocyte Antigen (HLA)-C as a Determinant in Inhibition of a Subset of Natural Killer Cells.
- D. M. Davis, O. Mandelboim, I. Luque, E. Baba, J. Boyson, and J. L. Strominger (1999)
J. Exp. Med.
189, 1265-1274
| Abstract »
| Full Text »
| PDF »
- Triggering of Effector Functions on a CD8+ T Cell Clone Upon the Aggregation of an Activatory CD94/kp39 Heterodimer.
- T. Bellon, A. B. d. Heredia, M. Llano, A. Minguela, A. Rodriguez, M. Lopez-Botet, and P. Aparicio (1999)
J. Immunol.
162, 3996-4002
| Abstract »
| Full Text »
| PDF »
- Differential binding to HLA-C of p50-activating and p58-inhibitory natural killer cell receptors.
- M. Vales-Gomez, H. T. Reyburn, R. A. Erskine, and J. Strominger (1998)
PNAS
95, 14326-14331
| Abstract »
| Full Text »
| PDF »
- Inhibitory and Stimulatory Functions of Paired Ig-Like Receptor (PIR) Family in RBL-2H3 Cells.
- Y. Yamashita, M. Ono, and T. Takai (1998)
J. Immunol.
161, 4042-4047
| Abstract »
| Full Text »
| PDF »
- Direct Binding and Functional Transfer of NK Cell Inhibitory Receptors Reveal Novel Patterns of HLA-C Allotype Recognition.
- C. C. Winter, J. E. Gumperz, P. Parham, E. O. Long, and N. Wagtmann (1998)
J. Immunol.
161, 571-577
| Abstract »
| Full Text »
| PDF »
- Natural killer activating receptors trigger interferon gamma secretion from T cells and natural killer cells.
- O. Mandelboim, S. Kent, D. M. Davis, S. B. Wilson, T. Okazaki, R. Jackson, D. Hafler, and J. L. Strominger (1998)
PNAS
95, 3798-3803
| Abstract »
| Full Text »
| PDF »
- Functional Role for Syk Tyrosine Kinase in Natural Killer Cell-mediated Natural Cytotoxicity.
- K. M. Brumbaugh, B. A. Binstadt, D. D. Billadeau, R. A. Schoon, C. J. Dick, R. M. Ten, and P. J. Leibson (1997)
J. Exp. Med.
186, 1965-1974
| Abstract »
| Full Text »
| PDF »
- What Goes Up Must Come Down: The Emerging Spectrum of Inhibitory Receptors.
- W. M. Yokoyama (1997)
J. Exp. Med.
186, 1803-1808
| Full Text »
| PDF »
- Preferential Interaction of a Novel Tumor Surface Protein (p38.5) with Naive Natural Killer Cells.
- B. Das, M. O. Mondragon, S.-Z. Tao, and A. J. Norin (1997)
J. Exp. Med.
185, 1735-1742
| Abstract »
| Full Text »
| PDF »
|
|