Related Content
Search Google Scholar for:
More Information
Related Jobs from ScienceCareers
|
|
Science 20 December 1996: Vol. 274. no. 5295, pp. 2057 - 2059 DOI: 10.1126/science.274.5295.2057
|
|
Reports
Loss of Heterozygosity in Normal Tissue Adjacent to Breast
Carcinomas
Guoren Deng,
You Lu,
Galina Zlotnikov,
Ann D. Thor,
Helene S. Smith
*
Loss of heterozygosity (LOH) was detected in morphologically normal
lobules adjacent to breast cancers. The most frequent aberration was at
chromosome 3p22-25; of ten cases with this LOH in the carcinoma, six
displayed the same LOH in adjacent normal lobules. This suggests that
in a subset of sporadic breast cancers, a tumor suppresser gene at
3p22-25 may be important in initiation or early progression of
tumorigenesis. Among sixteen breast cancers with LOH at 17p13.1 and
five breast cancers with LOH at 11p15.5, one case each displayed the
same LOH in adjacent normal lobules. Thus the molecular heterogeneity
that characterizes invasive breast cancers may occur at the earliest
detectable stages of progression.
G. Deng, Y. Lu, G. Zlotnikov, Geraldine Brush Cancer Research
Institute, California Pacific Medical Center, 2330 Clay Street, San
Francisco, CA 94619, USA.
A. D. Thor, Department of Pathology, Northwestern University School of
Medicine, Evanston Hospital, 2650 Ridge Avenue, Evanston, IL 60201, USA.
H. S. Smith, Geraldine Brush Cancer Research Institute, California
Pacific Medical Center, 2330 Clay Street, San Francisco, CA 94619, and
Department of Medicine, University of California, San Francisco, CA
94143, USA.
*
To whom correspondence should be addressed.
The mature breast contains lobules,
clusters of closed glandular spaces that produce milk during lactation.
These lobules are connected to the nipple-areolar complex by a system
of branching ducts that are surrounded by varying amounts of fat and
connective tissue. Breast cancer is thought to develop within a
terminal ductal-lobular unit (TDLU), which includes the lobule and its most proximal ducts (1).
Breast cancer evolves by clonal selection of cells that acquire
multiple molecular changes. One model suggests that breast cancer, like
colon cancer (2), develops through a defined progression of
morphologically distinguishable stages beginning with benign hyperplasia, which progresses to atypical hyperplasia, then to in situ
carcinoma, and finally to invasive cancer (1). This sequential progression may not be the only way that breast cancers develop, however. Many small invasive cancers do not have atypical components, which suggests that they may have developed directly from
morphologically normal epithelium. If this were true, one might expect
to find evidence of a "field effect" in which at least some of the
genetic aberrations found in invasive cancers are also present in the
morphologically normal epithelium.
To test this hypothesis, we carefully microdissected
hematoxylin-eosin-stained sections of breast cancers so as to isolate morphologically discrete regions (Fig. 1A). DNA was
prepared from malignant areas of the section and from adjacent
normal TDLUs. As a control for each case, DNA was also prepared from
normal breast skin (usually from a separate section) that had been
similarly microdissected.
Fig. 1.
Normal histology and absence of
HER-2/neu overexpression in TDLUs adjacent to breast carcinomas.
(A) One of the TDLUs (solid arrow) subsequently used for
microdissection. The surrounding stroma was scraped away with a
scalpel, and a clean blade used to remove the TDLU to a test tube for
DNA extraction (11, 14). Note that the carcinoma areas
(open arrow) are clearly separated from the morphologically normal
TDLUs (hematoxylin-eosin stain). (B) The same TDLU as in
(A) before removal of the surrounding stroma. The higher magnification
illustrates that it is histologically normal (hematoxylin-eosin stain).
(C) Overexpression of HER-2/neu in the malignant epithelial
cells, detected by immunostaining of the surface membranes (large
arrow); cells in the adjacent TDLU (small arrow) show no
immunostaining. Scale bars indicate 150 µm in (A) and 30 µm in (B)
and (C).
[View Larger Version of this Image (115K GIF file)]
We studied LOH at chromosome 3p24, 11p15.5, 13q13, and 17p13.1 because
these loci show LOH in a high percentage ( 30 to 60%) of invasive
ductal breast cancers (3, 4). For the carcinomatous regions,
the frequency of LOH at 3p24 (48%) and 11p15.5 (29%) was similar to
that previously reported (4). The frequency of LOH in the
invasive components was higher than the literature values for 13q13
(64% here versus 40%) and for 17p13.1 (80% here versus 60%).
These discrepancies may be due to random variation because our sample
size was small.
In 8 of 30 cases we detected LOH in the adjacent morphologically normal
TDLUs (Table 1). In all eight cases, the same allele was
missing in the adjacent carcinoma (Fig. 2, A and B). LOH
in normal TDLUs was seen in 6 of the 10 cases where LOH at 3p24 was found in the carcinoma. LOH at 11p15.5 in the normal TDLUs was seen in
one of five cases with this LOH in the carcinoma; LOH at 17p13.1 in the
normal TDLUs was seen in 1 of 16 cases with this LOH in the carcinoma.
None of 10 cases with LOH at 13q13 in the carcinoma had this lesion in
the normal TDLUs. Among tumors with and without LOH in adjacent normal
tissues, there was no significant difference in grade, hormone receptor
status, degree of differentiation, tumor size, or proliferative
fraction, although the number of cases may have been too small to
detect minor differences.
Fig. 2.
LOH at different loci on
chromosome 3p in breast cancer and adjacent normal lobules. The density
of each allele was determined and the relative densities of the two
alleles in each lane were compared to their relative densities in skin
(14, 15). (A) LOH at 3p24 of DNA from case H21
(PCR primers EABMD). Lane 1, normal skin; lane 2, distant normal TDLU;
lanes 3 to 6, four different adjacent normal TDLUs; lane 7, carcinoma
component appearing as DCIS; lane 8, a second carcinoma component
appearing as invasive tumor. Note that the same allele is lost in all
samples. (B) LOH at 3p24 of DNA from case H12 (PCR primers
D3S1244). Lane 1, normal skin; lane 2, morphologically normal TDLU
adjacent to the tumor; lane 3, carcinoma component appearing as DCIS;
lane 4, a second carcinoma component appearing as invasive tumor. Note that the same allele is lost in all samples. (C) LOH at various loci on chromosome 3p in morphologically normal TDLUs from case
H40. Lanes 1 and 2, chromosomal locus 3p25 (PCR primers D3S1597); lanes
3 and 4, chromosomal locus 3p24 (PCR primers EABMD); lanes 5 and 6, chromosomal locus 3p21 (PCR primers D3S1573; for this locus, the two
alleles are separated by only 2 base pairs, but are readily
distinguished on the film). Note that LOH is detectable in adjacent
normal TDLU at 3p25 and 3p24, but not at 3p21. Lanes 1, 3, and 5 contain normal skin samples; lanes 2, 4, and 6 contain samples from
morphologically normal TDLUs adjacent to the tumor. (D) LOH
was measured at various loci on chromosome 3p and the results
summarized for each case where the adjacent normal TDLUs had LOH at
chromosome 3p. The loci tested (numbered 1 to 8 in the figure) are: 1, 3p26 (D3S2397); 2, 3p25 (D3S1597); 3, 3p24 (EABH or EABMD); 4, 3p24
(D3S1244); 5, 3p22 (D3S1612); 6, 3p22 (D3S1582); 7, 3p21 (D3S1573); and
8, 3p21 (D3S1295). The common region of LOH falls within the region
3p25 to 3p22 as indicated by the solid line. Black spheres indicate LOH
present; open spheres indicate no LOH; striped spheres indicate not
informative.
[View Larger Versions of these Images (54K GIF file)]
We performed several control experiments to show that the polymerase
chain reaction (PCR) technique was reproducible and that the normal
TDLUs chosen for dissection were free of contaminating cancer cells. To
evaluate reproducibility of the assay, we repeated the LOH assays two
to five times using the same DNA preparations (documented for cases H12
and H21 in Table 2). Although in some cases, there were
variations in the relative intensity of the two bands, in each repeat
assay the same allele was lost. If the LOH had been due to random
artifacts of assay methodology, one would expect to see either allele
lost in repeat experiments. Because only a small amount of DNA was
available from the microdissected samples, we used 45 PCR cycles to
amplify the DNA before electrophoresis. Skewing of microsatellite
markers in favor of the smaller allele was controlled for, as we always
expressed allele density relative to that for normal skin from the same
person. Furthermore, we showed that the density ratios of the upper to
lower alleles were the same after 30 and 45 cycles using microsatellite
probe D3S1244 with one tumor DNA sample. For the eight cases reported
(Table 1), the lower allele was lost in 6 of 15 assays showing LOH with microsatellite probes, a result consistent with random loss of the
upper or lower allele. To investigate possible artifacts related to DNA
preparation, we evaluated case H21 by dissecting four individual TDLUs
and extracting the DNA separately. Again, in each adjacent TDLU, the
same allele was lost (Table 2 and Fig. 2A).
Table 2.
LOH at 3p24 in normal mammary TDLUs adjacent to
carcinoma.
| Case |
Density of upper allele: density
of lower allele*
|
| DNA from distant normal TDLUs |
DNA from adjacent
normal TDLUs |
|
| H12 |
| Pooled
TDLUs |
1.0 : 0.95 |
0.51 : 1.0
|
| Pooled TDLUs |
NT |
0.31 : 1.0 |
| Pooled
TDLUs |
NT |
0.42 : 1.0 |
| Pooled
TDLUs |
NT |
0.13 : 1.0 |
| H21 |
| Pooled
TDLUs |
1.0 : 0.92 |
1.0 : 0.03 |
| Pooled
TDLUs |
NT |
1.0 : 0.05 |
| TDLU 1 |
NT |
1.0 : 0.05
|
| TDLU 2 |
NT |
1.0 : 0.1 |
| TDLU
3 |
NT |
1.0 : 0.05 |
| TDLU 4 |
NT |
1.0 : 0.05
|
| H22 |
1.0 : 0.97 |
1.0 : 0.56
|
| H37 |
1.0 : 1.0 |
0.25 : 1.0 |
|
|
*
Values were calculated as in Fig. 2. NT, not tested.
|
|
Contamination of the adjacent TDLUs with cancer cells was excluded by
two experiments. First, the TDLUs used for each microdissection appeared morphologically normal by the following criteria: They contained clusters of small ductules composed of a single myoepithelial basal layer and a single cuboidal luminal layer with clear and prominent lumina, and the cells had uniform, small nuclei with diffusely distributed chromatin (Fig. 1B). Second, for seven of the
eight cases, we demonstrated that the cancer cells contained additional
molecular aberrations not detected in the adjacent normal TDLUs (Table
1). These aberrations included LOHs at other chromosomal loci and
abnormal immunopositivity for the tumor suppressor protein p53 or the
oncoprotein, HER-2/neu. For example, DNA from the normal TDLUs of cases
H12, H21, H37, and H40 showed LOH at 3p24 but not at 17p13.1 even
though the carcinomas showed LOH at both loci (Table 1). DNA from the
normal TDLUs of case H5 showed LOH at 11p15.5 and case H6 showed LOH at
17p13.1; both cases showed LOH at 13q13 in the carcinomas but not in
adjacent TDLUs (Table 1). If tumor DNA contaminated the normal
material, one would expect the same LOH profile in the normal and tumor material. Additionally, in cases where the tumor components contained cells immunopositive for HER-2/neu (cases H22, H37, and H40) or p53
(cases H12 and H40), there were no immunopositive cells in the adjacent
normal TDLUs (Fig. 1C and Table 1).
To determine whether the LOH at 3p was present in all of the
normal mammary epithelium or only in the normal TDLUs adjacent to the
carcinoma, we evaluated mastectomy tissue (available from four of the
six cases) showing LOH at 3p in adjacent normal TDLUs. In all four
cases, TDLUs taken from blocks distant to the carcinomas showed no LOH
(Table 2). Thus the 3p LOH was present only in a localized region of
normal epithelium near the carcinoma rather than in the entire mammary
tree.
To evaluate the extent of the LOH, we characterized each case
with LOH at 3p24 in the normal TDLUs for LOH at additional loci on 3p.
The size of the chromosomal region showing LOH in the morphologically normal TDLUs differed among the cases. For example, case H40 showed LOH
at 3p26 (Fig. 2D), 3p25, and 3p24 (Fig. 2C) but not at 3p21 (Fig. 2, C
and D). In contrast, cases H12 and H21 both showed LOH at 3p24 (Fig. 2,
A and B), but not at 3p25 (Fig. 2D). However, all cases shared a region
of LOH within 3p25 (locus D3S1597) to 3p22 (locus D3S1612) (Fig. 2D).
In summary, we have shown that the normal mammary TDLUs near a
breast cancer contain genetic aberrations that have previously been
seen only in hyperplastic (5), premalignant
(5, 6, 7), and malignant breast epithelium (3, 4) as
well as colonic adenomas (2), Barrett's esophageal
metaplasia (8, 9), and lung hyperplasias (10).
The presence of the LOH only in TDLUs near the cancer suggests that the
entire mammary gland is not affected. Because regions with LOH are
thought to contain recessive genes relevant to malignancy, LOH in the
normal adjacent lobules may define a localized predisposed region from
which the cancer arises. Conceivably, this predisposed region may be
present prior to mammary gland differentiation, as single stem cells
form localized regions of the mammary gland (11).
Epidemiologic evidence supports the notion that breast cancer
initiation can occur prior to mammary gland differentiation: for
example, breast cancer risk was found to be high in women who were in
the first decade of life at the time of exposure to atomic bomb
irradiation and in women who had undergone thymus irradiation in
infancy (12, 13).
If LOH in normal lobules defines a localized region of increased risk,
its presence may be clinically important. Because the adjacent mammary
epithelium is not completely removed during lumpectomy for invasive
carcinoma or ductal carcinoma in situ (DCIS), remaining cells with the
LOH may subsequently progress to form another carcinoma. Thus,
additional studies should be undertaken to determine if patients with
LOH in their normal TDLUs are more likely to have a tumor recurrence
than patients whose normal TDLUs are not genetically aberrant. If there
is a correlation, analysis of the adjacent normal TDLUs might help to
identify patients who would benefit from more aggressive local therapy
or who should be counseled about their higher risk for local failure.
REFERENCES AND NOTES
-
S. R. Wellings,
Pathol. Res. Pract.
166,
515
(1980)
[Medline].
-
E. R. Fearson and
B. Vogelstein,
Cell
61,
759
(1990)
.
-
S. H. Dairkee and H. S. Smith, J. Mamm. Gland Biol.
Neoplasia 1, 139 (1996).
-
K. Takita
et al.,
Cancer Res.
52,
3914
(1992)
[Medline];
T. I. Anderson
et al.,
Genes Chromosomes Cancer
4,
113
(1992)
; P. Devilee and
C. J. Cornelisse, Biochem. Biophys. Acta. 1198, 113 (1994);
Y. Harada
et al.,
Cancer
74,
2281
(1994)
[Medline].
-
R. A. Jensen,
D. L. Page,
J. T. Holt,
Proc. Natl. Acad. Sci. U.S.A.
91,
9257
(1994)
[Medline].
-
P. O'Connell,
V. Pekkel,
S. Fuqua,
C. K. Osborne,
C. Allred,
Breast Cancer Res. Treat
32,
5
(1994)
.
-
D. M. Radford
et al.,
Cancer Res.
53,
2947
(1993)
[Medline].
-
P. L. Blount
et al.,
ibid.
54,
2292
(1994)
[Medline].
-
Z. Zhuang
et al.,
ibid.
56,
1961
(1996)
[Medline].
-
A. F. Gazdar et al., abstract presented at the
eighty-sixth Annual Meeting of the American Association for Cancer
Research, March 1995, Toronto, Canada.
-
Y. C. Tsai
et al.,
Cancer Res.
56,
402
(1996)
[Medline].
-
M. Tokunaga, C. E. Land, T. Yamamoto, in Breast Cancer
Among Atomic Bomb Survivors, J. D. Boice Jr. and J. F. Fraumeni
Jr., Eds. (Raven Press, New York, 1984), pp. 45-46.
-
N. G. Hildreth,
R. E. Shore,
P. M. Dvoretsky,
N. Engl. J. Med.
321,
1281
(1989)
[Medline].
-
Formalin-fixed, paraffin-embedded histologic sections stained
with hematoxylin-eosin were reviewed to identify slides containing both
carcinoma and morphologically normal TDLUs on the same section.
Selected areas of sections from 30 such cases were microdissected using
a light microscope (11). A similarly stained section of
normal breast skin from the same patient was microdissected as a
control. Adjacent 4-µm sections were immunostained for p53 and
HER-2/neu as in H. B. Muss et al. [N. Engl.
J. Med. 330, 1260 (1994)]. Microdissected tissue was
extracted with 100 µl of xylene, washed with 100 µl of 95%
ethanol, and the DNA extracted (11). The DNA (4 µl) was
amplified by PCR in 50 µl of 10 mM tris-HCl (pH 8.3), 50 mM KCl, 2 mM
MgCl2, 0.01% gelatin, 200 µM each of deoxyadenosine
triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine
triphosphate (dCTP) and deoxythymidine triphospate (dTTP), 0.1 µM upstream and downstream primers, 1% dimethyl sulfoxide (DMSO),
0.44 µg Thermus aquaticus (Taq) antibody
(TaqStart antibody, Clontech), and 2 units of Taq DNA
polymerase C [D. K. Wright and M. M. Manos, in PCR Protocols: A
Guide to Methods and Applications, M. A. Innes, D. H. Gelfand, J. J. Sninsky, T. J. White, Eds. (Academic Press, San Diego, CA, 1990),
pp. 153-158]. The PCR reaction consisted of 45 cycles of denaturing
(94°C for 30 s), annealing (56 to 66°C for 30 sec.), and chain
extension (72°C for 30 s). The PCR products were separated by
electrophoresis [
G. Deng
et al.,
Cancer Res.
54,
499
(1994)
[Medline]]. Each allele of the PCR product was
measured by densitometry of x-ray film exposed to the gel or of a
negative photographic film of the ethidium bromide-stained gel. The
density ratios of the two alleles (the undigested allele: the digested
allele, or the top allele: the bottom allele) for different tissues
were calculated. The density of each allele was determined (using a
Computing Densitometer by Molecular Dynamics, Model 300A) and the
relative densities of the two alleles in each lane were compared to
their relative densities in skin. Samples were scored as positive for
LOH if the calculated value was <0.70 according to the following
equation:
density of weaker allele of sample : density of stronger
allele of sample/density of weaker allele of skin : density of stronger
allele of skin . This calculated ratio for each lane in Fig. 2
relative to skin (lane 1) is as follows: Fig. 2A, lane 2, 0.95; lanes 3 to 8, <0.10; Fig. 2B, lane 2, 0.31; lane 3, 0.29; lane 4, 0.37; Fig.
2C, lane 2, 0.15; lane 4, 0.25; lane 6, 0.93.
-
The primer pairs included restriction fragment length
polymorphisms (RFLPs), C-A repeat, and tetranucleotide microsatellite
polymorphic loci. The sequences of the PCR primers for LOH analysis are
as follows (in each case, the forward primer is followed by the reverse
primer): 3p26 (16) D3S2397:
ATAGAGCCACACTTTGTCTCA:
TCTTTGAGAACCACTGTCTCC; 3p25 (16) D3S1597:
AGTACAAATACACACAAATGTCTC: GCAAATCGTTCATTGCT; 3p24
(17) EABH: CATCTGAAATGCTGACCTGTT:
AGCTGTCAGAACTAAGTGCTT; 3p24 (18) EABMD:
AACGTTGGACCTCAAGCCCAT: AGAATGCCAAGGAAGGGTGCA; 3p24
(19) D3S1244:
GTGCCCTTCCAGGAGTT:AGTGAGGCATCCACTACC; 3p22
(16) D3S1612:
TCTTTTAGTCAGCAGTTATGTC: CCC-
ATTAAGAAATGTTACTCTAC; 3p22 (16) D3S1582:
AGCAGGTACTATGAAAGCCTGT: GGAACAGCCCA- T G GTTCAC; 3p21
(16) D3S1573:
TTCATTTTTGCTTATTAAGATATGC:
CCAGTAAATNACAGGGCTAT; 3p21 (16) D3S1295:
TGTAGTAATGGTTTCATGGATACAC:
ATTTTATAAGTTTTGATACCCTCCC;
11p15.5 (20) TH2:CAGCTGCCCTAGTCAGCAC: GCTTCCGA-
GTGCAGGTCACA; 13q13 (21) D13S218:
GATTTGAAAATGAGCAGTCC: GTCGGGCACTACGTTATCT;
13q13 (21) D13S219: AAGCAAATATGCAAAATTGC:
TCCTTCTGTTTCTGACTTAACA; 17p13.1
(22) TP53.5: CAATGGATGATTTGATGCTG:
TGGTAGGTTTTCTGGGAAGG; 17p13.1 (23)
TP53.6: AGGT- CTGGTTTGCAACTGGG: GAGGTCAAATAAGCAGCAGG;
17p13.1 (24) TP53.8:T: CAGAAGGAAGTAGGAAGGACTCAG:
GAAGAGCCTCGGTTATGGGTAT- ACA.
-
Genome database (http://www-genome.wi.mit.edu).
-
P. S. Ganly and
P. H. Rabbitts,
Nucleic Acids Res.
19,
3761
(1991)
.
-
___, ibid., p. 3760.
-
H. Li
et al.,
Hum. Mol. Genet.
1,
425
(1992)
.
-
M. H. Polymeropoulos,
H. Xiao,
D. S. Rath,
C. R. Merril,
Nucleic Acids Res.
19,
3753
(1991)
.
-
J. Weissenbach
et al.,
Nature
359,
794
(1992)
[Medline].
-
S. Olschwang,
P. Laurent-Puig,
A. Vassal,
R. J. Salmon,
G. Thomas,
Hum. Genet.
86,
369
(1991)
[Medline].
-
T. McDaniel
et al.,
Nucleic Acids Res.
19,
6969
(1991)
.
-
H. Saito,
T. Sakamoto,
T. Sato,
Y. Nakamura,
Cytogenet. Cell Genet.
58,
1806
(1991)
.
-
Supported by National Cancer Institute SPORE grant
2P50CA58207.
31 May 1996; accepted 18 November
1996
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES:
- Super competition as a possible mechanism to pioneer precancerous fields.
- C. Rhiner and E. Moreno (2009)
Carcinogenesis
30, 723-728
| Abstract »
| Full Text »
| PDF »
- Breast Stromal Enhancement on MRI Is Associated with Response to Neoadjuvant Chemotherapy.
- J. Hattangadi, C. Park, J. Rembert, C. Klifa, J. Hwang, J. Gibbs, and N. Hylton (2008)
Am. J. Roentgenol.
190, 1630-1636
| Abstract »
| Full Text »
| PDF »
- Fibronectin Expression Modulates Mammary Epithelial Cell Proliferation during Acinar Differentiation.
- C. M. Williams, A. J. Engler, R. D. Slone, L. L. Galante, and J. E. Schwarzbauer (2008)
Cancer Res.
68, 3185-3192
| Abstract »
| Full Text »
| PDF »
- The Theory of the Sick Breast Lobe and the Possible Consequences.
- T. Tot (2007)
International Journal of Surgical Pathology
15, 369-375
| Abstract »
| PDF »
- Heterogenic Loss of the Wild-Type BRCA Allele in Human Breast Tumorigenesis.
- T. A. King, W. Li, E. Brogi, C. J. Yee, M. L. Gemignani, N. Olvera, D. A. Levine, L. Norton, M. E. Robson, K. Offit, et al. (2007)
Ann. Surg. Oncol.
14, 2510-2518
| Abstract »
| Full Text »
| PDF »
- Hypermethylation of the Breast Cancer-Associated Gene 1 Promoter Does Not Predict Cytologic Atypia or Correlate with Surrogate End Points of Breast Cancer Risk.
- G. R. Bean, C. Ibarra Drendall, V. K. Goldenberg, J. C. Baker Jr., M. M. Troch, C. Paisie, L. G. Wilke, L. Yee, P. K. Marcom, B. F. Kimler, et al. (2007)
Cancer Epidemiol. Biomarkers Prev.
16, 50-56
| Abstract »
| Full Text »
| PDF »
- Mapping Geographic Zones of Cancer Risk with Epigenetic Biomarkers in Normal Breast Tissue..
- P. S. Yan, C. Venkataramu, A. Ibrahim, J. C. Liu, R. Z. Shen, N. M. Diaz, B. Centeno, F. Weber, Y.-W. Leu, C. L. Shapiro, et al. (2006)
Clin. Cancer Res.
12, 6626-6636
| Abstract »
| Full Text »
| PDF »
- Unfavourable prognosis associated with K-ras gene mutation in pancreatic cancer surgical margins.
- J Kim, H A Reber, S M Dry, D Elashoff, S L Chen, N Umetani, M Kitago, O J Hines, K K Kazanjian, S Hiramatsu, et al. (2006)
Gut
55, 1598-1605
| Abstract »
| Full Text »
| PDF »
- p53 Alterations and Protein Accumulation in Benign Breast Tissue and Breast Cancer Risk: A Cohort Study..
- T. E. Rohan, S.-Q. Li, R. Hartwick, and R. A. Kandel (2006)
Cancer Epidemiol. Biomarkers Prev.
15, 1316-1323
| Abstract »
| Full Text »
| PDF »
- Topographic Molecular Profile of Pheochromocytomas: Role of Somatic Down-Regulation of Mismatch Repair.
- A. Blanes, J. J. Sanchez-Carrillo, and S. J. Diaz-Cano (2006)
J. Clin. Endocrinol. Metab.
91, 1150-1158
| Abstract »
| Full Text »
| PDF »
- Accurate genotyping from paraffin-embedded normal tissue adjacent to breast cancer.
- B. Xie, J. L. Freudenheim, S. S. Cummings, B. Singh, H. He, S. E. McCann, K. B. Moysich, and P. G. Shields (2006)
Carcinogenesis
27, 307-310
| Abstract »
| Full Text »
| PDF »
- Allele Imbalance, or Loss of Heterozygosity, in Normal Breast Epithelium of Sporadic Breast Cancer Cases and BRCA1 Gene Mutation Carriers Is Increased Compared With Reduction Mammoplasty Tissues.
- P. S. Larson, B. L. Schlechter, A. de las Morenas, J. E. Garber, L. A. Cupples, and C. L. Rosenberg (2005)
J. Clin. Oncol.
23, 8613-8619
| Abstract »
| Full Text »
| PDF »
- Int6 Expression Can Predict Survival in Early-Stage Non-Small Cell Lung Cancer Patients.
- F. Buttitta, C. Martella, F. Barassi, L. Felicioni, S. Salvatore, S. Rosini, T. D'Antuono, A. Chella, F. Mucilli, R. Sacco, et al. (2005)
Clin. Cancer Res.
11, 3198-3204
| Abstract »
| Full Text »
| PDF »
- Retinoic Acid Receptor-{beta}2 Promoter Methylation in Random Periareolar Fine Needle Aspiration.
- G. R. Bean, V. Scott, L. Yee, B. Ratliff-Daniel, M. M. Troch, P. Seo, M. L. Bowie, P. K. Marcom, J. Slade, B. F. Kimler, et al. (2005)
Cancer Epidemiol. Biomarkers Prev.
14, 790-798
| Abstract »
| Full Text »
| PDF »
- Alteration of Gene Expression in Macroscopically Normal Colonic Mucosa from Individuals with a Family History of Sporadic Colon Cancer.
- C.-Y. Hao, D. H. Moore, P. Wong, J. L. Bennington, N. M. Lee, and L.-C. Chen (2005)
Clin. Cancer Res.
11, 1400-1407
| Abstract »
| Full Text »
| PDF »
- Genetic and Epigenetic Changes in Mammary Epithelial Cells Identify a Subpopulation of Cells Involved in Early Carcinogenesis.
- H. BERMAN, J. ZHANG, Y.G. CRAWFORD, M.L. GAUTHIER, C.A. FORDYCE, K.M. McDERMOTT, M. SIGAROUDINIA, K. KOZAKIEWICZ, and T.D. TLSTY (2005)
Cold Spring Harb Symp Quant Biol
70, 317-327
| Abstract »
| PDF »
- A Novel RAR{beta} Isoform Directed by a Distinct Promoter P3 and Mediated by Retinoic Acid in Breast Cancer Cells.
- X. Peng, T. Maruo, Y. Cao, V. Punj, R. Mehta, T. K. Das Gupta, and K. Christov (2004)
Cancer Res.
64, 8911-8918
| Abstract »
| Full Text »
| PDF »
- Endometrial Glandular Dysplasia: A Putative Precursor Lesion of Uterine Papillary Serous Carcinoma. Part II: Molecular Features.
- S. X. Liang, S. K. Chambers, L. Cheng, S. Zhang, Y. Zhou, and W. Zheng (2004)
International Journal of Surgical Pathology
12, 319-331
| Abstract »
| PDF »
- Stable 'portrait' of breast tumors during progression: data from biology, pathology and genetics.
- M Lacroix, R-A Toillon, and G Leclercq (2004)
Endocr. Relat. Cancer
11, 497-522
| Abstract »
| Full Text »
| PDF »
- Outer Breast Quadrants Demonstrate Increased Levels of Genomic Instability.
- D. L. Ellsworth, R. E. Ellsworth, B. Love, B. Deyarmin, S. M. Lubert, V. Mittal, J. A. Hooke, and C. D. Shriver (2004)
Ann. Surg. Oncol.
11, 861-868
| Abstract »
| Full Text »
| PDF »
- Quantitative Multiplex Methylation-Specific PCR Assay for the Detection of Promoter Hypermethylation in Multiple Genes in Breast Cancer.
- M. J. Fackler, M. McVeigh, J. Mehrotra, M. A. Blum, J. Lange, A. Lapides, E. Garrett, P. Argani, and S. Sukumar (2004)
Cancer Res.
64, 4442-4452
| Abstract »
| Full Text »
| PDF »
- Watch thy neighbor: cancer is a communal affair.
- V. M. Weaver and P. Gilbert (2004)
J. Cell Sci.
117, 1287-1290
| Abstract »
| Full Text »
| PDF »
- Telomere Shortening Occurs in Subsets of Normal Breast Epithelium as well as in Situ and Invasive Carcinoma.
- A. K. Meeker, J. L. Hicks, E. Gabrielson, W. M. Strauss, A. M. De Marzo, and P. Argani (2004)
Am. J. Pathol.
164, 925-935
| Abstract »
| Full Text »
| PDF »
- Prognostic significance of the allelic loss of the BRCA1 gene in colorectal cancer.
- J M Garcia, R Rodriguez, G Dominguez, J M Silva, M Provencio, J Silva, A Colmenarejo, I Millan, C Munoz, C Salas, et al. (2003)
Gut
52, 1756-1763
| Abstract »
| Full Text »
| PDF »
- Stroma Adjacent to Metastatic Mature Teratoma after Chemotherapy for Testicular Germ Cell Tumors Is Derived from the Same Progenitor Cells as the Teratoma.
- D. W. Brandli, T. M. Ulbright, R. S. Foster, O. W. Cummings, S. Zhang, C. J. Sweeney, J. N. Eble, and L. Cheng (2003)
Cancer Res.
63, 6063-6068
| Abstract »
| Full Text »
| PDF »
- Detection of Gene Promoter Hypermethylation in Fine Needle Washings from Breast Lesions.
- C. Jeronimo, I. Costa, M. C. Martins, P. Monteiro, S. Lisboa, C. Palmeira, R. Henrique, M. R. Teixeira, and C. Lopes (2003)
Clin. Cancer Res.
9, 3413-3417
| Abstract »
| Full Text »
| PDF »
- The Quest for a General Theory of Aging and Longevity.
- L. A. Gavrilov and N. S. Gavrilova (2003)
Sci. Aging Knowl. Environ.
2003, re5-5
| Abstract »
| Full Text »
| PDF »
- Identification and Characterization of Retinoic Acid Receptor {beta}2 Target Genes in F9 Teratocarcinoma Cells.
- Y. Zhuang, T. N. Faria, P. Chambon, and L. J. Gudas (2003)
Mol. Cancer Res.
1, 619-630
| Abstract »
| Full Text »
| PDF »
- Gene expression profiles of human breast cancer progression.
- X.-J. Ma, R. Salunga, J. T. Tuggle, J. Gaudet, E. Enright, P. McQuary, T. Payette, M. Pistone, K. Stecker, B. M. Zhang, et al. (2003)
PNAS
100, 5974-5979
| Abstract »
| Full Text »
| PDF »
- Methylation of p16INK4a Promoters Occurs in Vivo in Histologically Normal Human Mammary Epithelia.
- C. R. Holst, G. J. Nuovo, M. Esteller, K. Chew, S. B. Baylin, J. G. Herman, and T. D. Tlsty (2003)
Cancer Res.
63, 1596-1601
| Abstract »
| Full Text »
| PDF »
- Clinical, Cellular, and Molecular Aspects of Cancer Invasion.
- M. Mareel and A. Leroy (2003)
Physiol Rev
83, 337-376
| Abstract »
| Full Text »
| PDF »
- Distinct Amplification of an Untranslated Regulatory Sequence in the egfr Gene Contributes to Early Steps in Breast Cancer Development.
- N. Tidow, A. Boecker, H. Schmidt, K. Agelopoulos, W. Boecker, H. Buerger, and B. Brandt (2003)
Cancer Res.
63, 1172-1178
| Abstract »
| Full Text »
| PDF »
- An adjunct mammary epithelial cell population in parous females: its role in functional adaptation and tissue renewal.
- K.-U. Wagner, C. A. Boulanger, M. D. Henry, M. Sgagias, L. Hennighausen, and G. H. Smith (2003)
Development
129, 1377-1386
| Abstract »
| Full Text »
| PDF »
- Comparative Analysis of Molecular Alterations in Fibroadenomas Associated or Not With Breast Cancer.
- N. Franco, L. Arnould, F. Mege, S.-F. Picard, P. Arveux, and S. Lizard-Nacol (2003)
Arch Surg
138, 291-295
| Abstract »
| Full Text »
| PDF »
- A Tumor-specific Kinase Activity Regulates the Viral Death Protein Apoptin.
- J. L. Rohn, Y.-H. Zhang, R. I. J. M. Aalbers, N. Otto, J. den Hertog, N. V. Henriquez, C. J. H. van de Velde, P. J. K. Kuppen, D. Mumberg, P. Donner, et al. (2002)
J. Biol. Chem.
277, 50820-50827
| Abstract »
| Full Text »
| PDF »
- Genes Involved in Breast Cancer Progression: Analysis of Global Changes in Gene Expression or Retroviral Tagging?.
- E. V. Schmidt (2002)
Am. J. Pathol.
161, 1973-1977
| Full Text »
| PDF »
- Tumor DNA in Plasma at Diagnosis of Breast Cancer Patients Is a Valuable Predictor of Disease-free Survival.
- J. M. Silva, J. Silva, A. Sanchez, J. M. Garcia, G. Dominguez, M. Provencio, L. Sanfrutos, E. Jareno, A. Colas, P. Espana, et al. (2002)
Clin. Cancer Res.
8, 3761-3766
| Abstract »
| Full Text »
| PDF »
- Genome-wide Allelotyping of a New in Vitro Model System Reveals Early Events in Breast Cancer Progression.
- Z. Li, Z. H. Meng, A. Sayeed, R. Shalaby, B.-M. Ljung, and S. H. Dairkee (2002)
Cancer Res.
62, 5980-5987
| Abstract »
| Full Text »
| PDF »
- Downstream Codons in the Retinoic Acid Receptor beta -2 and beta -4 mRNAs Initiate Translation of a Protein Isoform That Disrupts Retinoid-activated Transcription.
- L. I. Chen, K. M. Sommer, and K. Swisshelm (2002)
J. Biol. Chem.
277, 35411-35421
| Abstract »
| Full Text »
| PDF »
- Loss of Heterozygosity or Allele Imbalance in Histologically Normal Breast Epithelium Is Distinct from Loss of Heterozygosity or Allele Imbalance in Co-Existing Carcinomas.
- P. S. Larson, A. de las Morenas, S. R. Bennett, L. A. Cupples, and C. L. Rosenberg (2002)
Am. J. Pathol.
161, 283-290
| Abstract »
| Full Text »
| PDF »
- Biallelic Inactivation of the Thyroid Hormone Receptor {beta}1 Gene in Early Stage Breast Cancer.
- Z. Li, Z. H. Meng, R. Chandrasekaran, W.-L. Kuo, C. C. Collins, J. W. Gray, and S. H. Dairkee (2002)
Cancer Res.
62, 1939-1943
| Abstract »
| Full Text »
| PDF »
- p14ARF Promoter Hypermethylation in Plasma DNA as an Indicator of Disease Recurrence in Bladder Cancer Patients.
- G. Dominguez, J. Carballido, J. Silva, J. M. Silva, J. M. Garcia, J. Menendez, M. Provencio, P. Espana, and F. Bonilla (2002)
Clin. Cancer Res.
8, 980-985
| Abstract »
| Full Text »
| PDF »
- Increased Risk of Local Recurrence Is Associated with Allelic Loss in Normal Lobules of Breast Cancer Patients.
- Z. Li, D. H. Moore, Z. H. Meng, B.-M. Ljung, J. W. Gray, and S. H. Dairkee (2002)
Cancer Res.
62, 1000-1003
| Abstract »
| Full Text »
| PDF »
- Breast Epithelium Procurement from Stereotactic Core Biopsy Washings: Flow Cytometry-sorted Cell Count Analysis.
- D. L. Stoler, C. C. Stewart, and P. C. Stomper (2002)
Clin. Cancer Res.
8, 428-432
| Abstract »
| Full Text »
| PDF »
- Persistence of Tumor DNA in Plasma of Breast Cancer Patients After Mastectomy.
- J. M. Silva, J. M. Garcia, G. Dominguez, J. Silva, C. Miralles, B. Cantos, S. Coca, M. Provencio, P. Espana, and F. Bonilla (2002)
Ann. Surg. Oncol.
9, 71-76
| Abstract »
| Full Text »
| PDF »
- Gene Expression Profile Analysis by DNA Microarrays: Promise and Pitfalls.
- H. C. King and A. A. Sinha (2001)
JAMA
286, 2280-2288
| Abstract »
| Full Text »
| PDF »
- Absence of Genetic Abnormalities in Fibroadenomas of the Breast Determined at p53 Gene Mutations and Microsatellite Alterations.
- N. Franco, S.-F. Picard, F. Mege, L. Arnould, and S. Lizard-Nacol (2001)
Cancer Res.
61, 7955-7958
| Abstract »
| Full Text »
| PDF »
- Chromosome 3p allele loss in early invasive breast cancer: detailed mapping and association with clinicopathological features.
- A Martinez, R A Walker, J A Shaw, S J Dearing, E R Maher, and F Latif (2001)
Mol. Pathol.
54, 300-306
| Abstract »
| Full Text »
| PDF »
- Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging.
- A. Krtolica, S. Parrinello, S. Lockett, P.-Y. Desprez, and J. Campisi (2001)
PNAS
| Abstract »
| Full Text »
| PDF »
- Genetic model of multi-step breast carcinogenesis involving the epithelium and stroma: clues to tumour-microenvironment interactions.
- K. Kurose, S. Hoshaw-Woodard, A. Adeyinka, S. Lemeshow, P. H. Watson, and C. Eng (2001)
Hum. Mol. Genet.
10, 1907-1913
| Abstract »
| Full Text »
| PDF »
- Germline RET 634 Mutation Positive MEN 2A-related C-Cell Hyperplasias Have Genetic Features Consistent with Intraepithelial Neoplasia.
- S. J. Diaz-Cano, M. de Miguel, A. Blanes, R. Tashjian, and H. J. Wolfe (2001)
J. Clin. Endocrinol. Metab.
86, 3948-3957
| Abstract »
| Full Text »
| PDF »
- High-Resolution Chromosome 3p Allelotyping of Breast Carcinomas and Precursor Lesions Demonstrates Frequent Loss of Heterozygosity and a Discontinuous Pattern of Allele Loss.
- A. Maitra, I. I. Wistuba, C. Washington, A. K. Virmani, R. Ashfaq, S. Milchgrub, A. F. Gazdar, and J. D. Minna (2001)
Am. J. Pathol.
159, 119-130
| Abstract »
| Full Text »
| PDF »
- Extensive Somatic Microsatellite Mutations in Normal Human Tissue.
- S. Vilkki, J.-L. Tsao, A. Loukola, M. Poyhonen, O. Vierimaa, R. Herva, L. A. Aaltonen, and D. Shibata (2001)
Cancer Res.
61, 4541-4544
| Abstract »
| Full Text »
| PDF »
- Genetic Progression and Heterogeneity Associated with the Development of Esophageal Squamous Cell Carcinoma.
- M. J. Roth, N. Hu, M. R. Emmert-Buck, Q.-H. Wang, S. M. Dawsey, G. Li, W.-J. Guo, Y.-Z. Zhang, and P. R. Taylor (2001)
Cancer Res.
61, 4098-4104
| Abstract »
| Full Text »
- Morphostats: A Missing Concept in Cancer Biology.
- J. D. Potter (2001)
Cancer Epidemiol. Biomarkers Prev.
10, 161-170
| Abstract »
| Full Text »
- Levels of Hypoxia-Inducible Factor-1{{alpha}} During Breast Carcinogenesis.
- R. Bos, H. Zhong, C. F. Hanrahan, E. C. M. Mommers, G. L. Semenza, H. M. Pinedo, M. D. Abeloff, J. W. Simons, P. J. van Diest, and E. van der Wall (2001)
J Natl Cancer Inst
93, 309-314
| Abstract »
| Full Text »
| PDF »
- Biallelic Inactivation of Retinoic Acid Receptor {beta}2 Gene by Epigenetic Change in Breast Cancer.
- Q. Yang, I. Mori, L. Shan, M. Nakamura, Y. Nakamura, H. Utsunomiya, G. Yoshimura, T. Suzuma, T. Tamaki, T. Umemura, et al. (2001)
Am. J. Pathol.
158, 299-303
| Abstract »
| Full Text »
| PDF »
- High Frequency of Chromosome 3p Deletion in Histologically Normal Nasopharyngeal Epithelia from Southern Chinese.
- A. S. C. Chan, K. F. To, K. W. Lo, K. F. Mak, W. Pak, B. Chiu, G. M. K. Tse, M. Ding, X. Li, J. C. K. Lee, et al. (2000)
Cancer Res.
60, 5365-5370
| Abstract »
| Full Text »
- Laser capture microdissection in pathology.
- F. Fend and M. Raffeld (2000)
J. Clin. Pathol.
53, 666-672
| Abstract »
| Full Text »
| PDF »
- Genetic and Epigenetic Alterations in Normal Bladder Epithelium in Patients with Metachronous Bladder Cancer.
- S. Muto, S. Horie, S. Takahashi, K. Tomita, and T. Kitamura (2000)
Cancer Res.
60, 4021-4025
| Abstract »
| Full Text »
- A Hypersensitive Estrogen Receptor-{{alpha}} Mutation in Premalignant Breast Lesions.
- S. A. W. Fuqua, C. Wiltschke, Q. X. Zhang, A. Borg, C. G. Castles, W. E. Friedrichs, T. Hopp, S. Hilsenbeck, S. Mohsin, P. OConnell, et al. (2000)
Cancer Res.
60, 4026-4029
| Abstract »
| Full Text »
- Loss of Heterozygosity in Fibrocystic Change of the Breast : Genetic Relationship Between Benign Proliferative Lesions and Associated Carcinomas.
- C. Washington, F. Dalbegue, F. Abreo, J. K. Taubenberger, and J. H. Lichy (2000)
Am. J. Pathol.
157, 323-329
| Abstract »
| Full Text »
| PDF »
- Immunohistochemical Analyses of Focal Adhesion Kinase Expression in Benign and Malignant Human Breast and Colon Tissues: Correlation with Preinvasive and Invasive Phenotypes.
- W. G. Cance, J. E. Harris, M. V. Iacocca, E. Roche, X. Yang, J. Chang, S. Simkins, and L. Xu (2000)
Clin. Cancer Res.
6, 2417-2423
| Abstract »
| Full Text »
- Methylation and Silencing of the Retinoic Acid Receptor-{beta}2 Gene in Breast Cancer.
- M. Widschwendter, J. Berger, M. Hermann, H. M. Muller, A. Amberger, M. Zeschnigk, A. Widschwendter, B. Abendstein, A. G. Zeimet, G. Daxenbichler, et al. (2000)
J Natl Cancer Inst
92, 826-832
| Abstract »
| Full Text »
| PDF »
- Multiplex Genotype Analysis of Invasive Carcinoma and Accompanying Proliferative Lesions Microdissected from Breast Tissue.
- X. Cui, H. Feiner, Z. Lin, and H. Li (2000)
J. Mol. Diagn.
2, 29-36
| Abstract »
| Full Text »
- Genetic Analysis of Head and Neck Squamous Cell Carcinoma and Surrounding Mucosa.
- N. D. Stafford, J. N. E. Ashman, A. W. MacDonald, S. R. Ell, J. R. T. Monson, and J. Greenman (1999)
Arch Otolaryngol Head Neck Surg
125, 1341-1348
| Abstract »
| Full Text »
| PDF »
- Clones and Subclones in the Lung Cancer Field.
- W. N. Hittelman (1999)
J Natl Cancer Inst
91, 1796-1799
| Full Text »
| PDF »
- High Frequency of Allelic Loss of BRCA2 Gene in Pregnancy-Associated Breast Carcinoma.
- T. Shen, A. O. Vortmeyer, Z. Zhuang, and F. A. Tavassoli (1999)
J Natl Cancer Inst
91, 1686-1687
| Full Text »
| PDF »
- Detecting Tumor-related Alterations in Plasma or Serum DNA of Patients Diagnosed with Breast Cancer.
- X. q. Chen, H. Bonnefoi, S. Diebold-Berger, J. Lyautey, C. Lederrey, E. Faltin-Traub, M. Stroun, and P. Anker (1999)
Clin. Cancer Res.
5, 2297-2303
| Abstract »
| Full Text »
| PDF »
- Loss of Heterozygosity at D14S62 and Metastatic Potential of Breast Cancer.
- P. O'Connell, K. Fischbach, S. Hilsenbeck, S. K. Mohsin, S. A. W. Fuqua, G. M. Clark, C. K. Osborne, and D. C. Allred (1999)
J Natl Cancer Inst
91, 1391-1397
| Abstract »
| Full Text »
| PDF »
- Elevated retinoic acid receptor beta 4 protein in human breast tumor cells with nuclear and cytoplasmic localization.
- K. M. Sommer, L. I. Chen, P. M. Treuting, L. T. Smith, and K. Swisshelm (1999)
PNAS
96, 8651-8656
| Abstract »
| Full Text »
| PDF »
- Presence of Tumor DNA in Plasma of Breast Cancer Patients: Clinicopathological Correlations.
- J. M. Silva, G. Dominguez, J. M. Garcia, R. Gonzalez, M. J. Villanueva, F. Navarro, M. Provencio, S. San Martin, P. Espana, and F. Bonilla (1999)
Cancer Res.
59, 3251-3256
| Abstract »
| Full Text »
| PDF »
- Retinoic Acid-mediated G1-S-Phase Arrest of Normal Human Mammary Epithelial Cells Is Independent of the Level of p53 Protein Expression.
- V. L. Seewaldt, E. C. Dietze, B. S. Johnson, S. J. Collins, and M. B. Parker (1999)
Cell Growth Differ.
10, 49-59
| Abstract »
| Full Text »
- Immuno-LCM: Laser Capture Microdissection of Immunostained Frozen Sections for mRNA Analysis.
- F. Fend, M. R. Emmert-Buck, R. Chuaqui, K. Cole, J. Lee, L. A. Liotta, and M. Raffeld (1999)
Am. J. Pathol.
154, 61-66
| Abstract »
| Full Text »
| PDF »
- Phenotype and Genotype of Advanced Premalignant Head and Neck Lesions After Chemopreventive Therapy.
- L. Mao, A. K. El-Naggar, V. Papadimitrakopoulou, D. M. Shin, H. C. Shin, Y. Fan, X. Zhou, G. Clayman, J. J. Lee, J. S. Lee, et al. (1998)
J Natl Cancer Inst
90, 1545-1551
| Abstract »
| PDF »
- The Long and Short of Chromosome 11 in Breast Cancer.
- I. F. Newsham (1998)
Am. J. Pathol.
153, 5-9
| Full Text »
| PDF »
- Loss of Heterozygosity on Chromosome 11p15 during Histological Progression in Microdissected Ductal Carcinoma of the Breast.
- J. H. Lichy, M. Zavar, M. M. Tsai, T. J. O'Leary, and J. K. Taubenberger (1998)
Am. J. Pathol.
153, 271-278
| Abstract »
| Full Text »
| PDF »
- Loss of the gene encoding mannose 6-phosphate/insulin-like growth factor II receptor is an early event in liver carcinogenesis.
- T. Yamada, A. T. De Souza, S. Finkelstein, and R. L. Jirtle (1997)
PNAS
94, 10351-10355
| Abstract »
| Full Text »
| PDF »
- Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging.
- A. Krtolica, S. Parrinello, S. Lockett, P.-Y. Desprez, and J. Campisi (2001)
PNAS
98, 12072-12077
| Abstract »
| Full Text »
| PDF »
|
|