Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.


Science 20 December 1996:
Vol. 274. no. 5295, pp. 2057 - 2059
DOI: 10.1126/science.274.5295.2057

Reports

Loss of Heterozygosity in Normal Tissue Adjacent to Breast Carcinomas

Guoren Deng, You Lu, Galina Zlotnikov, Ann D. Thor, Helene S. Smith *

Loss of heterozygosity (LOH) was detected in morphologically normal lobules adjacent to breast cancers. The most frequent aberration was at chromosome 3p22-25; of ten cases with this LOH in the carcinoma, six displayed the same LOH in adjacent normal lobules. This suggests that in a subset of sporadic breast cancers, a tumor suppresser gene at 3p22-25 may be important in initiation or early progression of tumorigenesis. Among sixteen breast cancers with LOH at 17p13.1 and five breast cancers with LOH at 11p15.5, one case each displayed the same LOH in adjacent normal lobules. Thus the molecular heterogeneity that characterizes invasive breast cancers may occur at the earliest detectable stages of progression.

G. Deng, Y. Lu, G. Zlotnikov, Geraldine Brush Cancer Research Institute, California Pacific Medical Center, 2330 Clay Street, San Francisco, CA 94619, USA.
A. D. Thor, Department of Pathology, Northwestern University School of Medicine, Evanston Hospital, 2650 Ridge Avenue, Evanston, IL 60201, USA.
H. S. Smith, Geraldine Brush Cancer Research Institute, California Pacific Medical Center, 2330 Clay Street, San Francisco, CA 94619, and Department of Medicine, University of California, San Francisco, CA 94143, USA.
*   To whom correspondence should be addressed.


The mature breast contains lobules, clusters of closed glandular spaces that produce milk during lactation. These lobules are connected to the nipple-areolar complex by a system of branching ducts that are surrounded by varying amounts of fat and connective tissue. Breast cancer is thought to develop within a terminal ductal-lobular unit (TDLU), which includes the lobule and its most proximal ducts (1).

Breast cancer evolves by clonal selection of cells that acquire multiple molecular changes. One model suggests that breast cancer, like colon cancer (2), develops through a defined progression of morphologically distinguishable stages beginning with benign hyperplasia, which progresses to atypical hyperplasia, then to in situ carcinoma, and finally to invasive cancer (1). This sequential progression may not be the only way that breast cancers develop, however. Many small invasive cancers do not have atypical components, which suggests that they may have developed directly from morphologically normal epithelium. If this were true, one might expect to find evidence of a "field effect" in which at least some of the genetic aberrations found in invasive cancers are also present in the morphologically normal epithelium.

To test this hypothesis, we carefully microdissected hematoxylin-eosin-stained sections of breast cancers so as to isolate morphologically discrete regions (Fig. 1A). DNA was prepared from malignant areas of the section and from adjacent normal TDLUs. As a control for each case, DNA was also prepared from normal breast skin (usually from a separate section) that had been similarly microdissected.


Fig. 1. Normal histology and absence of HER-2/neu overexpression in TDLUs adjacent to breast carcinomas. (A) One of the TDLUs (solid arrow) subsequently used for microdissection. The surrounding stroma was scraped away with a scalpel, and a clean blade used to remove the TDLU to a test tube for DNA extraction (11, 14). Note that the carcinoma areas (open arrow) are clearly separated from the morphologically normal TDLUs (hematoxylin-eosin stain). (B) The same TDLU as in (A) before removal of the surrounding stroma. The higher magnification illustrates that it is histologically normal (hematoxylin-eosin stain). (C) Overexpression of HER-2/neu in the malignant epithelial cells, detected by immunostaining of the surface membranes (large arrow); cells in the adjacent TDLU (small arrow) show no immunostaining. Scale bars indicate 150 µm in (A) and 30 µm in (B) and (C). [View Larger Version of this Image (115K GIF file)]

We studied LOH at chromosome 3p24, 11p15.5, 13q13, and 17p13.1 because these loci show LOH in a high percentage (sim 30 to 60%) of invasive ductal breast cancers (3, 4). For the carcinomatous regions, the frequency of LOH at 3p24 (48%) and 11p15.5 (29%) was similar to that previously reported (4). The frequency of LOH in the invasive components was higher than the literature values for 13q13 (64% here versus sim 40%) and for 17p13.1 (80% here versus sim 60%). These discrepancies may be due to random variation because our sample size was small.

In 8 of 30 cases we detected LOH in the adjacent morphologically normal TDLUs (Table 1). In all eight cases, the same allele was missing in the adjacent carcinoma (Fig. 2, A and B). LOH in normal TDLUs was seen in 6 of the 10 cases where LOH at 3p24 was found in the carcinoma. LOH at 11p15.5 in the normal TDLUs was seen in one of five cases with this LOH in the carcinoma; LOH at 17p13.1 in the normal TDLUs was seen in 1 of 16 cases with this LOH in the carcinoma. None of 10 cases with LOH at 13q13 in the carcinoma had this lesion in the normal TDLUs. Among tumors with and without LOH in adjacent normal tissues, there was no significant difference in grade, hormone receptor status, degree of differentiation, tumor size, or proliferative fraction, although the number of cases may have been too small to detect minor differences.

Table 1. Analysis of breast cancers and adjacent normal TDLUs for LOH and for p53 and HER-2/neu immunopositivity. The samples were a sequential series of infiltrating ductal carcinoma from mastectomies in which the carcinomatous elements contained at least 10% ductal carcinoma in situ (DCIS) and invasive cancer in the same tissue section (14). N, normal TDLU adjacent to carcinoma; C, cancer; +, LOH; -, no LOH; NI, not informative; NT, not tested; *Fractions are the number of cases with LOH over the number of informative cases; dagger Indicated range reflects the variability seen in different areas of the malignant component. HER-2/neu was more heterogeneous than p53 in its immunostaining pattern; the DCIS components showed more staining than the invasive components.


Case Loss of heterozygosity
Immunopositive (%)
3p24
11p15.5
13q13
17p13.1
p53
HER-2/neu
N 6/17* C 10/21 N 1/16 C 5/17 N 0/11 C 10/14 N 1/19 C 16/20 N C N C

H12 + +  - + NI NI  - + 0 1 0 0
H21 + + NI NI NI NI  - + 0 0 0 0
H22 + +  -  - NT + NI NI 0 0 0 30-60dagger
H36 + +  -  - NI NI NI NI 0 0 0 0
H37 + + NI NI NT +  - + 0 0 0 5-10
H40 + +  -  -  -  -  - + 0 10 0 30-70
H5 NI NI + +  - + NI NI 0 0 0 0
H6 NI NI  -  -  - + + + 0 0 0 0



Fig. 2. LOH at different loci on chromosome 3p in breast cancer and adjacent normal lobules. The density of each allele was determined and the relative densities of the two alleles in each lane were compared to their relative densities in skin (14, 15). (A) LOH at 3p24 of DNA from case H21 (PCR primers EABMD). Lane 1, normal skin; lane 2, distant normal TDLU; lanes 3 to 6, four different adjacent normal TDLUs; lane 7, carcinoma component appearing as DCIS; lane 8, a second carcinoma component appearing as invasive tumor. Note that the same allele is lost in all samples. (B) LOH at 3p24 of DNA from case H12 (PCR primers D3S1244). Lane 1, normal skin; lane 2, morphologically normal TDLU adjacent to the tumor; lane 3, carcinoma component appearing as DCIS; lane 4, a second carcinoma component appearing as invasive tumor. Note that the same allele is lost in all samples. (C) LOH at various loci on chromosome 3p in morphologically normal TDLUs from case H40. Lanes 1 and 2, chromosomal locus 3p25 (PCR primers D3S1597); lanes 3 and 4, chromosomal locus 3p24 (PCR primers EABMD); lanes 5 and 6, chromosomal locus 3p21 (PCR primers D3S1573; for this locus, the two alleles are separated by only 2 base pairs, but are readily distinguished on the film). Note that LOH is detectable in adjacent normal TDLU at 3p25 and 3p24, but not at 3p21. Lanes 1, 3, and 5 contain normal skin samples; lanes 2, 4, and 6 contain samples from morphologically normal TDLUs adjacent to the tumor. (D) LOH was measured at various loci on chromosome 3p and the results summarized for each case where the adjacent normal TDLUs had LOH at chromosome 3p. The loci tested (numbered 1 to 8 in the figure) are: 1, 3p26 (D3S2397); 2, 3p25 (D3S1597); 3, 3p24 (EABH or EABMD); 4, 3p24 (D3S1244); 5, 3p22 (D3S1612); 6, 3p22 (D3S1582); 7, 3p21 (D3S1573); and 8, 3p21 (D3S1295). The common region of LOH falls within the region 3p25 to 3p22 as indicated by the solid line. Black spheres indicate LOH present; open spheres indicate no LOH; striped spheres indicate not informative. [View Larger Versions of these Images (54K GIF file)]

We performed several control experiments to show that the polymerase chain reaction (PCR) technique was reproducible and that the normal TDLUs chosen for dissection were free of contaminating cancer cells. To evaluate reproducibility of the assay, we repeated the LOH assays two to five times using the same DNA preparations (documented for cases H12 and H21 in Table 2). Although in some cases, there were variations in the relative intensity of the two bands, in each repeat assay the same allele was lost. If the LOH had been due to random artifacts of assay methodology, one would expect to see either allele lost in repeat experiments. Because only a small amount of DNA was available from the microdissected samples, we used 45 PCR cycles to amplify the DNA before electrophoresis. Skewing of microsatellite markers in favor of the smaller allele was controlled for, as we always expressed allele density relative to that for normal skin from the same person. Furthermore, we showed that the density ratios of the upper to lower alleles were the same after 30 and 45 cycles using microsatellite probe D3S1244 with one tumor DNA sample. For the eight cases reported (Table 1), the lower allele was lost in 6 of 15 assays showing LOH with microsatellite probes, a result consistent with random loss of the upper or lower allele. To investigate possible artifacts related to DNA preparation, we evaluated case H21 by dissecting four individual TDLUs and extracting the DNA separately. Again, in each adjacent TDLU, the same allele was lost (Table 2 and Fig. 2A).

Table 2. LOH at 3p24 in normal mammary TDLUs adjacent to carcinoma.


Case Density of upper allele: density of lower allele*
DNA from distant normal TDLUs DNA from adjacent normal TDLUs

H12
Pooled TDLUs 1.0 : 0.95 0.51 : 1.0 
Pooled TDLUs NT 0.31 : 1.0 
Pooled TDLUs NT 0.42 : 1.0 
Pooled TDLUs NT 0.13 : 1.0 
H21
Pooled TDLUs 1.0 : 0.92 1.0  : 0.03
Pooled TDLUs NT 1.0  : 0.05
TDLU 1 NT 1.0  : 0.05
TDLU 2 NT 1.0  : 0.1 
TDLU 3 NT 1.0  : 0.05
TDLU 4 NT 1.0  : 0.05
H22 1.0 : 0.97 1.0  : 0.56
H37 1.0 : 1.0  0.25 : 1.0 

* Values were calculated as in Fig. 2. NT, not tested.

Contamination of the adjacent TDLUs with cancer cells was excluded by two experiments. First, the TDLUs used for each microdissection appeared morphologically normal by the following criteria: They contained clusters of small ductules composed of a single myoepithelial basal layer and a single cuboidal luminal layer with clear and prominent lumina, and the cells had uniform, small nuclei with diffusely distributed chromatin (Fig. 1B). Second, for seven of the eight cases, we demonstrated that the cancer cells contained additional molecular aberrations not detected in the adjacent normal TDLUs (Table 1). These aberrations included LOHs at other chromosomal loci and abnormal immunopositivity for the tumor suppressor protein p53 or the oncoprotein, HER-2/neu. For example, DNA from the normal TDLUs of cases H12, H21, H37, and H40 showed LOH at 3p24 but not at 17p13.1 even though the carcinomas showed LOH at both loci (Table 1). DNA from the normal TDLUs of case H5 showed LOH at 11p15.5 and case H6 showed LOH at 17p13.1; both cases showed LOH at 13q13 in the carcinomas but not in adjacent TDLUs (Table 1). If tumor DNA contaminated the normal material, one would expect the same LOH profile in the normal and tumor material. Additionally, in cases where the tumor components contained cells immunopositive for HER-2/neu (cases H22, H37, and H40) or p53 (cases H12 and H40), there were no immunopositive cells in the adjacent normal TDLUs (Fig. 1C and Table 1).

To determine whether the LOH at 3p was present in all of the normal mammary epithelium or only in the normal TDLUs adjacent to the carcinoma, we evaluated mastectomy tissue (available from four of the six cases) showing LOH at 3p in adjacent normal TDLUs. In all four cases, TDLUs taken from blocks distant to the carcinomas showed no LOH (Table 2). Thus the 3p LOH was present only in a localized region of normal epithelium near the carcinoma rather than in the entire mammary tree.

To evaluate the extent of the LOH, we characterized each case with LOH at 3p24 in the normal TDLUs for LOH at additional loci on 3p. The size of the chromosomal region showing LOH in the morphologically normal TDLUs differed among the cases. For example, case H40 showed LOH at 3p26 (Fig. 2D), 3p25, and 3p24 (Fig. 2C) but not at 3p21 (Fig. 2, C and D). In contrast, cases H12 and H21 both showed LOH at 3p24 (Fig. 2, A and B), but not at 3p25 (Fig. 2D). However, all cases shared a region of LOH within 3p25 (locus D3S1597) to 3p22 (locus D3S1612) (Fig. 2D).

In summary, we have shown that the normal mammary TDLUs near a breast cancer contain genetic aberrations that have previously been seen only in hyperplastic (5), premalignant (5, 6, 7), and malignant breast epithelium (3, 4) as well as colonic adenomas (2), Barrett's esophageal metaplasia (8, 9), and lung hyperplasias (10). The presence of the LOH only in TDLUs near the cancer suggests that the entire mammary gland is not affected. Because regions with LOH are thought to contain recessive genes relevant to malignancy, LOH in the normal adjacent lobules may define a localized predisposed region from which the cancer arises. Conceivably, this predisposed region may be present prior to mammary gland differentiation, as single stem cells form localized regions of the mammary gland (11). Epidemiologic evidence supports the notion that breast cancer initiation can occur prior to mammary gland differentiation: for example, breast cancer risk was found to be high in women who were in the first decade of life at the time of exposure to atomic bomb irradiation and in women who had undergone thymus irradiation in infancy (12, 13).

If LOH in normal lobules defines a localized region of increased risk, its presence may be clinically important. Because the adjacent mammary epithelium is not completely removed during lumpectomy for invasive carcinoma or ductal carcinoma in situ (DCIS), remaining cells with the LOH may subsequently progress to form another carcinoma. Thus, additional studies should be undertaken to determine if patients with LOH in their normal TDLUs are more likely to have a tumor recurrence than patients whose normal TDLUs are not genetically aberrant. If there is a correlation, analysis of the adjacent normal TDLUs might help to identify patients who would benefit from more aggressive local therapy or who should be counseled about their higher risk for local failure.


REFERENCES AND NOTES

  1. S. R. Wellings, Pathol. Res. Pract. 166, 515 (1980) [Medline].
  2. E. R. Fearson and B. Vogelstein, Cell 61, 759 (1990) .
  3. S. H. Dairkee and H. S. Smith, J. Mamm. Gland Biol. Neoplasia 1, 139 (1996).
  4. K. Takita et al., Cancer Res. 52, 3914 (1992) [Medline]; T. I. Anderson et al., Genes Chromosomes Cancer 4, 113 (1992) ; P. Devilee and C. J. Cornelisse, Biochem. Biophys. Acta. 1198, 113 (1994); Y. Harada et al., Cancer 74, 2281 (1994) [Medline].
  5. R. A. Jensen, D. L. Page, J. T. Holt, Proc. Natl. Acad. Sci. U.S.A. 91, 9257 (1994) [Medline].
  6. P. O'Connell, V. Pekkel, S. Fuqua, C. K. Osborne, C. Allred, Breast Cancer Res. Treat 32, 5 (1994) .
  7. D. M. Radford et al., Cancer Res. 53, 2947 (1993) [Medline].
  8. P. L. Blount et al., ibid. 54, 2292 (1994) [Medline].
  9. Z. Zhuang et al., ibid. 56, 1961 (1996) [Medline].
  10. A. F. Gazdar et al., abstract presented at the eighty-sixth Annual Meeting of the American Association for Cancer Research, March 1995, Toronto, Canada.
  11. Y. C. Tsai et al., Cancer Res. 56, 402 (1996) [Medline].
  12. M. Tokunaga, C. E. Land, T. Yamamoto, in Breast Cancer Among Atomic Bomb Survivors, J. D. Boice Jr. and J. F. Fraumeni Jr., Eds. (Raven Press, New York, 1984), pp. 45-46.
  13. N. G. Hildreth, R. E. Shore, P. M. Dvoretsky, N. Engl. J. Med. 321, 1281 (1989) [Medline].
  14. Formalin-fixed, paraffin-embedded histologic sections stained with hematoxylin-eosin were reviewed to identify slides containing both carcinoma and morphologically normal TDLUs on the same section. Selected areas of sections from 30 such cases were microdissected using a light microscope (11). A similarly stained section of normal breast skin from the same patient was microdissected as a control. Adjacent 4-µm sections were immunostained for p53 and HER-2/neu as in H. B. Muss et al. [N. Engl. J. Med. 330, 1260 (1994)]. Microdissected tissue was extracted with 100 µl of xylene, washed with 100 µl of 95% ethanol, and the DNA extracted (11). The DNA (4 µl) was amplified by PCR in 50 µl of 10 mM tris-HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 0.01% gelatin, 200 µM each of deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP) and deoxythymidine triphospate (dTTP), 0.1 µM upstream and downstream primers, 1% dimethyl sulfoxide (DMSO), 0.44 µg Thermus aquaticus (Taq) antibody (TaqStart antibody, Clontech), and 2 units of Taq DNA polymerase C [D. K. Wright and M. M. Manos, in PCR Protocols: A Guide to Methods and Applications, M. A. Innes, D. H. Gelfand, J. J. Sninsky, T. J. White, Eds. (Academic Press, San Diego, CA, 1990), pp. 153-158]. The PCR reaction consisted of 45 cycles of denaturing (94°C for 30 s), annealing (56 to 66°C for 30 sec.), and chain extension (72°C for 30 s). The PCR products were separated by electrophoresis [ G. Deng et al., Cancer Res. 54, 499 (1994) [Medline]]. Each allele of the PCR product was measured by densitometry of x-ray film exposed to the gel or of a negative photographic film of the ethidium bromide-stained gel. The density ratios of the two alleles (the undigested allele: the digested allele, or the top allele: the bottom allele) for different tissues were calculated. The density of each allele was determined (using a Computing Densitometer by Molecular Dynamics, Model 300A) and the relative densities of the two alleles in each lane were compared to their relative densities in skin. Samples were scored as positive for LOH if the calculated value was <0.70 according to the following equation: par density of weaker allele of sample : density of stronger allele of sample/density of weaker allele of skin : density of stronger allele of skinpar . This calculated ratio for each lane in Fig. 2 relative to skin (lane 1) is as follows: Fig. 2A, lane 2, 0.95; lanes 3 to 8, <0.10; Fig. 2B, lane 2, 0.31; lane 3, 0.29; lane 4, 0.37; Fig. 2C, lane 2, 0.15; lane 4, 0.25; lane 6, 0.93.
  15. The primer pairs included restriction fragment length polymorphisms (RFLPs), C-A repeat, and tetranucleotide microsatellite polymorphic loci. The sequences of the PCR primers for LOH analysis are as follows (in each case, the forward primer is followed by the reverse primer): 3p26 (16) D3S2397: ATAGAGCCACACTTTGTCTCA: TCTTTGAGAACCACTGTCTCC; 3p25 (16) D3S1597: AGTACAAATACACACAAATGTCTC: GCAAATCGTTCATTGCT; 3p24 (17) EABH: CATCTGAAATGCTGACCTGTT: AGCTGTCAGAACTAAGTGCTT; 3p24 (18) EABMD: AACGTTGGACCTCAAGCCCAT: AGAATGCCAAGGAAGGGTGCA; 3p24 (19) D3S1244: GTGCCCTTCCAGGAGTT:AGTGAGGCATCCACTACC; 3p22 (16) D3S1612: TCTTTTAGTCAGCAGTTATGTC: CCC- ATTAAGAAATGTTACTCTAC; 3p22 (16) D3S1582: AGCAGGTACTATGAAAGCCTGT: GGAACAGCCCA- T G GTTCAC; 3p21 (16) D3S1573: TTCATTTTTGCTTATTAAGATATGC: CCAGTAAATNACAGGGCTAT; 3p21 (16) D3S1295: TGTAGTAATGGTTTCATGGATACAC: ATTTTATAAGTTTTGATACCCTCCC; 11p15.5 (20) TH2:CAGCTGCCCTAGTCAGCAC: GCTTCCGA- GTGCAGGTCACA; 13q13 (21) D13S218: GATTTGAAAATGAGCAGTCC: GTCGGGCACTACGTTATCT; 13q13 (21) D13S219: AAGCAAATATGCAAAATTGC: TCCTTCTGTTTCTGACTTAACA; 17p13.1 (22) TP53.5: CAATGGATGATTTGATGCTG: TGGTAGGTTTTCTGGGAAGG; 17p13.1 (23) TP53.6: AGGT- CTGGTTTGCAACTGGG: GAGGTCAAATAAGCAGCAGG; 17p13.1 (24) TP53.8:T: CAGAAGGAAGTAGGAAGGACTCAG: GAAGAGCCTCGGTTATGGGTAT- ACA.
  16. Genome database (http://www-genome.wi.mit.edu).
  17. P. S. Ganly and P. H. Rabbitts, Nucleic Acids Res. 19, 3761 (1991) .
  18. ___, ibid., p. 3760.
  19. H. Li et al., Hum. Mol. Genet. 1, 425 (1992) .
  20. M. H. Polymeropoulos, H. Xiao, D. S. Rath, C. R. Merril, Nucleic Acids Res. 19, 3753 (1991) .
  21. J. Weissenbach et al., Nature 359, 794 (1992) [Medline].
  22. S. Olschwang, P. Laurent-Puig, A. Vassal, R. J. Salmon, G. Thomas, Hum. Genet. 86, 369 (1991) [Medline].
  23. T. McDaniel et al., Nucleic Acids Res. 19, 6969 (1991) .
  24. H. Saito, T. Sakamoto, T. Sato, Y. Nakamura, Cytogenet. Cell Genet. 58, 1806 (1991) .
  25. Supported by National Cancer Institute SPORE grant 2P50CA58207.

31 May 1996; accepted 18 November 1996



THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES:
Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis.
J. E. Visvader (2009)
Genes & Dev. 23, 2563-2577
   Abstract »    Full Text »    PDF »
Super competition as a possible mechanism to pioneer precancerous fields.
C. Rhiner and E. Moreno (2009)
Carcinogenesis 30, 723-728
   Abstract »    Full Text »    PDF »
Breast Stromal Enhancement on MRI Is Associated with Response to Neoadjuvant Chemotherapy.
J. Hattangadi, C. Park, J. Rembert, C. Klifa, J. Hwang, J. Gibbs, and N. Hylton (2008)
Am. J. Roentgenol. 190, 1630-1636
   Abstract »    Full Text »    PDF »
Fibronectin Expression Modulates Mammary Epithelial Cell Proliferation during Acinar Differentiation.
C. M. Williams, A. J. Engler, R. D. Slone, L. L. Galante, and J. E. Schwarzbauer (2008)
Cancer Res. 68, 3185-3192
   Abstract »    Full Text »    PDF »
The Theory of the Sick Breast Lobe and the Possible Consequences.
T. Tot (2007)
International Journal of Surgical Pathology 15, 369-375
   Abstract »    PDF »
Hypermethylation of the Breast Cancer-Associated Gene 1 Promoter Does Not Predict Cytologic Atypia or Correlate with Surrogate End Points of Breast Cancer Risk.
G. R. Bean, C. Ibarra Drendall, V. K. Goldenberg, J. C. Baker Jr., M. M. Troch, C. Paisie, L. G. Wilke, L. Yee, P. K. Marcom, B. F. Kimler, et al. (2007)
Cancer Epidemiol. Biomarkers Prev. 16, 50-56
   Abstract »    Full Text »    PDF »
Mapping Geographic Zones of Cancer Risk with Epigenetic Biomarkers in Normal Breast Tissue..
P. S. Yan, C. Venkataramu, A. Ibrahim, J. C. Liu, R. Z. Shen, N. M. Diaz, B. Centeno, F. Weber, Y.-W. Leu, C. L. Shapiro, et al. (2006)
Clin. Cancer Res. 12, 6626-6636
   Abstract »    Full Text »    PDF »
Unfavourable prognosis associated with K-ras gene mutation in pancreatic cancer surgical margins.
J Kim, H A Reber, S M Dry, D Elashoff, S L Chen, N Umetani, M Kitago, O J Hines, K K Kazanjian, S Hiramatsu, et al. (2006)
Gut 55, 1598-1605
   Abstract »    Full Text »    PDF »
p53 Alterations and Protein Accumulation in Benign Breast Tissue and Breast Cancer Risk: A Cohort Study..
T. E. Rohan, S.-Q. Li, R. Hartwick, and R. A. Kandel (2006)
Cancer Epidemiol. Biomarkers Prev. 15, 1316-1323
   Abstract »    Full Text »    PDF »
Topographic Molecular Profile of Pheochromocytomas: Role of Somatic Down-Regulation of Mismatch Repair.
A. Blanes, J. J. Sanchez-Carrillo, and S. J. Diaz-Cano (2006)
J. Clin. Endocrinol. Metab. 91, 1150-1158
   Abstract »    Full Text »    PDF »
Accurate genotyping from paraffin-embedded normal tissue adjacent to breast cancer.
B. Xie, J. L. Freudenheim, S. S. Cummings, B. Singh, H. He, S. E. McCann, K. B. Moysich, and P. G. Shields (2006)
Carcinogenesis 27, 307-310
   Abstract »    Full Text »    PDF »
Allele Imbalance, or Loss of Heterozygosity, in Normal Breast Epithelium of Sporadic Breast Cancer Cases and BRCA1 Gene Mutation Carriers Is Increased Compared With Reduction Mammoplasty Tissues.
P. S. Larson, B. L. Schlechter, A. de las Morenas, J. E. Garber, L. A. Cupples, and C. L. Rosenberg (2005)
J. Clin. Oncol. 23, 8613-8619
   Abstract »    Full Text »    PDF »
Int6 Expression Can Predict Survival in Early-Stage Non-Small Cell Lung Cancer Patients.
F. Buttitta, C. Martella, F. Barassi, L. Felicioni, S. Salvatore, S. Rosini, T. D'Antuono, A. Chella, F. Mucilli, R. Sacco, et al. (2005)
Clin. Cancer Res. 11, 3198-3204
   Abstract »    Full Text »    PDF »
Retinoic Acid Receptor-{beta}2 Promoter Methylation in Random Periareolar Fine Needle Aspiration.
G. R. Bean, V. Scott, L. Yee, B. Ratliff-Daniel, M. M. Troch, P. Seo, M. L. Bowie, P. K. Marcom, J. Slade, B. F. Kimler, et al. (2005)
Cancer Epidemiol. Biomarkers Prev. 14, 790-798
   Abstract »    Full Text »    PDF »
Alteration of Gene Expression in Macroscopically Normal Colonic Mucosa from Individuals with a Family History of Sporadic Colon Cancer.
C.-Y. Hao, D. H. Moore, P. Wong, J. L. Bennington, N. M. Lee, and L.-C. Chen (2005)
Clin. Cancer Res. 11, 1400-1407
   Abstract »    Full Text »    PDF »
Genetic and Epigenetic Changes in Mammary Epithelial Cells Identify a Subpopulation of Cells Involved in Early Carcinogenesis.
H. BERMAN, J. ZHANG, Y.G. CRAWFORD, M.L. GAUTHIER, C.A. FORDYCE, K.M. McDERMOTT, M. SIGAROUDINIA, K. KOZAKIEWICZ, and T.D. TLSTY (2005)
Cold Spring Harb Symp Quant Biol 70, 317-327
   Abstract »    PDF »
A Novel RAR{beta} Isoform Directed by a Distinct Promoter P3 and Mediated by Retinoic Acid in Breast Cancer Cells.
X. Peng, T. Maruo, Y. Cao, V. Punj, R. Mehta, T. K. Das Gupta, and K. Christov (2004)
Cancer Res. 64, 8911-8918
   Abstract »    Full Text »    PDF »
Endometrial Glandular Dysplasia: A Putative Precursor Lesion of Uterine Papillary Serous Carcinoma. Part II: Molecular Features.
S. X. Liang, S. K. Chambers, L. Cheng, S. Zhang, Y. Zhou, and W. Zheng (2004)
International Journal of Surgical Pathology 12, 319-331
   Abstract »    PDF »
Stable 'portrait' of breast tumors during progression: data from biology, pathology and genetics.
M Lacroix, R-A Toillon, and G Leclercq (2004)
Endocr. Relat. Cancer 11, 497-522
   Abstract »    Full Text »    PDF »
Quantitative Multiplex Methylation-Specific PCR Assay for the Detection of Promoter Hypermethylation in Multiple Genes in Breast Cancer.
M. J. Fackler, M. McVeigh, J. Mehrotra, M. A. Blum, J. Lange, A. Lapides, E. Garrett, P. Argani, and S. Sukumar (2004)
Cancer Res. 64, 4442-4452
   Abstract »    Full Text »    PDF »
Watch thy neighbor: cancer is a communal affair.
V. M. Weaver and P. Gilbert (2004)
J. Cell Sci. 117, 1287-1290
   Abstract »    Full Text »    PDF »
Telomere Shortening Occurs in Subsets of Normal Breast Epithelium as well as in Situ and Invasive Carcinoma.
A. K. Meeker, J. L. Hicks, E. Gabrielson, W. M. Strauss, A. M. De Marzo, and P. Argani (2004)
Am. J. Pathol. 164, 925-935
   Abstract »    Full Text »    PDF »
Prognostic significance of the allelic loss of the BRCA1 gene in colorectal cancer.
J M Garcia, R Rodriguez, G Dominguez, J M Silva, M Provencio, J Silva, A Colmenarejo, I Millan, C Munoz, C Salas, et al. (2003)
Gut 52, 1756-1763
   Abstract »    Full Text »    PDF »
Stroma Adjacent to Metastatic Mature Teratoma after Chemotherapy for Testicular Germ Cell Tumors Is Derived from the Same Progenitor Cells as the Teratoma.
D. W. Brandli, T. M. Ulbright, R. S. Foster, O. W. Cummings, S. Zhang, C. J. Sweeney, J. N. Eble, and L. Cheng (2003)
Cancer Res. 63, 6063-6068
   Abstract »    Full Text »    PDF »
Detection of Gene Promoter Hypermethylation in Fine Needle Washings from Breast Lesions.
C. Jeronimo, I. Costa, M. C. Martins, P. Monteiro, S. Lisboa, C. Palmeira, R. Henrique, M. R. Teixeira, and C. Lopes (2003)
Clin. Cancer Res. 9, 3413-3417
   Abstract »    Full Text »    PDF »
The Quest for a General Theory of Aging and Longevity.
L. A. Gavrilov and N. S. Gavrilova (2003)
Sci. Aging Knowl. Environ. 2003, re5-5
   Abstract »    Full Text »    PDF »
Identification and Characterization of Retinoic Acid Receptor {beta}2 Target Genes in F9 Teratocarcinoma Cells.
Y. Zhuang, T. N. Faria, P. Chambon, and L. J. Gudas (2003)
Mol. Cancer Res. 1, 619-630
   Abstract »    Full Text »    PDF »
Gene expression profiles of human breast cancer progression.
X.-J. Ma, R. Salunga, J. T. Tuggle, J. Gaudet, E. Enright, P. McQuary, T. Payette, M. Pistone, K. Stecker, B. M. Zhang, et al. (2003)
PNAS 100, 5974-5979
   Abstract »    Full Text »    PDF »
Methylation of p16INK4a Promoters Occurs in Vivo in Histologically Normal Human Mammary Epithelia.
C. R. Holst, G. J. Nuovo, M. Esteller, K. Chew, S. B. Baylin, J. G. Herman, and T. D. Tlsty (2003)
Cancer Res. 63, 1596-1601
   Abstract »    Full Text »    PDF »
Clinical, Cellular, and Molecular Aspects of Cancer Invasion.
M. Mareel and A. Leroy (2003)
Physiol Rev 83, 337-376
   Abstract »    Full Text »    PDF »
Distinct Amplification of an Untranslated Regulatory Sequence in the egfr Gene Contributes to Early Steps in Breast Cancer Development.
N. Tidow, A. Boecker, H. Schmidt, K. Agelopoulos, W. Boecker, H. Buerger, and B. Brandt (2003)
Cancer Res. 63, 1172-1178
   Abstract »    Full Text »    PDF »
An adjunct mammary epithelial cell population in parous females: its role in functional adaptation and tissue renewal.
K.-U. Wagner, C. A. Boulanger, M. D. Henry, M. Sgagias, L. Hennighausen, and G. H. Smith (2003)
Development 129, 1377-1386
   Abstract »    Full Text »    PDF »
Comparative Analysis of Molecular Alterations in Fibroadenomas Associated or Not With Breast Cancer.
N. Franco, L. Arnould, F. Mege, S.-F. Picard, P. Arveux, and S. Lizard-Nacol (2003)
Arch Surg 138, 291-295
   Abstract »    Full Text »    PDF »
A Tumor-specific Kinase Activity Regulates the Viral Death Protein Apoptin.
J. L. Rohn, Y.-H. Zhang, R. I. J. M. Aalbers, N. Otto, J. den Hertog, N. V. Henriquez, C. J. H. van de Velde, P. J. K. Kuppen, D. Mumberg, P. Donner, et al. (2002)
J. Biol. Chem. 277, 50820-50827
   Abstract »    Full Text »    PDF »
Genes Involved in Breast Cancer Progression: Analysis of Global Changes in Gene Expression or Retroviral Tagging?.
E. V. Schmidt (2002)
Am. J. Pathol. 161, 1973-1977
   Full Text »    PDF »
Tumor DNA in Plasma at Diagnosis of Breast Cancer Patients Is a Valuable Predictor of Disease-free Survival.
J. M. Silva, J. Silva, A. Sanchez, J. M. Garcia, G. Dominguez, M. Provencio, L. Sanfrutos, E. Jareno, A. Colas, P. Espana, et al. (2002)
Clin. Cancer Res. 8, 3761-3766
   Abstract »    Full Text »    PDF »
Genome-wide Allelotyping of a New in Vitro Model System Reveals Early Events in Breast Cancer Progression.
Z. Li, Z. H. Meng, A. Sayeed, R. Shalaby, B.-M. Ljung, and S. H. Dairkee (2002)
Cancer Res. 62, 5980-5987
   Abstract »    Full Text »    PDF »
Downstream Codons in the Retinoic Acid Receptor beta -2 and beta -4 mRNAs Initiate Translation of a Protein Isoform That Disrupts Retinoid-activated Transcription.
L. I. Chen, K. M. Sommer, and K. Swisshelm (2002)
J. Biol. Chem. 277, 35411-35421
   Abstract »    Full Text »    PDF »
Loss of Heterozygosity or Allele Imbalance in Histologically Normal Breast Epithelium Is Distinct from Loss of Heterozygosity or Allele Imbalance in Co-Existing Carcinomas.
P. S. Larson, A. de las Morenas, S. R. Bennett, L. A. Cupples, and C. L. Rosenberg (2002)
Am. J. Pathol. 161, 283-290
   Abstract »    Full Text »    PDF »
Biallelic Inactivation of the Thyroid Hormone Receptor {beta}1 Gene in Early Stage Breast Cancer.
Z. Li, Z. H. Meng, R. Chandrasekaran, W.-L. Kuo, C. C. Collins, J. W. Gray, and S. H. Dairkee (2002)
Cancer Res. 62, 1939-1943
   Abstract »    Full Text »    PDF »
p14ARF Promoter Hypermethylation in Plasma DNA as an Indicator of Disease Recurrence in Bladder Cancer Patients.
G. Dominguez, J. Carballido, J. Silva, J. M. Silva, J. M. Garcia, J. Menendez, M. Provencio, P. Espana, and F. Bonilla (2002)
Clin. Cancer Res. 8, 980-985
   Abstract »    Full Text »    PDF »
Increased Risk of Local Recurrence Is Associated with Allelic Loss in Normal Lobules of Breast Cancer Patients.
Z. Li, D. H. Moore, Z. H. Meng, B.-M. Ljung, J. W. Gray, and S. H. Dairkee (2002)
Cancer Res. 62, 1000-1003
   Abstract »    Full Text »    PDF »
Breast Epithelium Procurement from Stereotactic Core Biopsy Washings: Flow Cytometry-sorted Cell Count Analysis.
D. L. Stoler, C. C. Stewart, and P. C. Stomper (2002)
Clin. Cancer Res. 8, 428-432
   Abstract »    Full Text »    PDF »
Gene Expression Profile Analysis by DNA Microarrays: Promise and Pitfalls.
H. C. King and A. A. Sinha (2001)
JAMA 286, 2280-2288
   Abstract »    Full Text »    PDF »
Absence of Genetic Abnormalities in Fibroadenomas of the Breast Determined at p53 Gene Mutations and Microsatellite Alterations.
N. Franco, S.-F. Picard, F. Mege, L. Arnould, and S. Lizard-Nacol (2001)
Cancer Res. 61, 7955-7958
   Abstract »    Full Text »    PDF »
Chromosome 3p allele loss in early invasive breast cancer: detailed mapping and association with clinicopathological features.
A Martinez, R A Walker, J A Shaw, S J Dearing, E R Maher, and F Latif (2001)
Mol. Pathol. 54, 300-306
   Abstract »    Full Text »    PDF »
Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging.
A. Krtolica, S. Parrinello, S. Lockett, P.-Y. Desprez, and J. Campisi (2001)
PNAS
   Abstract »    Full Text »    PDF »
Genetic model of multi-step breast carcinogenesis involving the epithelium and stroma: clues to tumour-microenvironment interactions.
K. Kurose, S. Hoshaw-Woodard, A. Adeyinka, S. Lemeshow, P. H. Watson, and C. Eng (2001)
Hum. Mol. Genet. 10, 1907-1913
   Abstract »    Full Text »    PDF »
Germline RET 634 Mutation Positive MEN 2A-related C-Cell Hyperplasias Have Genetic Features Consistent with Intraepithelial Neoplasia.
S. J. Diaz-Cano, M. de Miguel, A. Blanes, R. Tashjian, and H. J. Wolfe (2001)
J. Clin. Endocrinol. Metab. 86, 3948-3957
   Abstract »    Full Text »    PDF »
High-Resolution Chromosome 3p Allelotyping of Breast Carcinomas and Precursor Lesions Demonstrates Frequent Loss of Heterozygosity and a Discontinuous Pattern of Allele Loss.
A. Maitra, I. I. Wistuba, C. Washington, A. K. Virmani, R. Ashfaq, S. Milchgrub, A. F. Gazdar, and J. D. Minna (2001)
Am. J. Pathol. 159, 119-130
   Abstract »    Full Text »    PDF »
Extensive Somatic Microsatellite Mutations in Normal Human Tissue.
S. Vilkki, J.-L. Tsao, A. Loukola, M. Poyhonen, O. Vierimaa, R. Herva, L. A. Aaltonen, and D. Shibata (2001)
Cancer Res. 61, 4541-4544
   Abstract »    Full Text »    PDF »
Genetic Progression and Heterogeneity Associated with the Development of Esophageal Squamous Cell Carcinoma.
M. J. Roth, N. Hu, M. R. Emmert-Buck, Q.-H. Wang, S. M. Dawsey, G. Li, W.-J. Guo, Y.-Z. Zhang, and P. R. Taylor (2001)
Cancer Res. 61, 4098-4104
   Abstract »    Full Text »
Morphostats: A Missing Concept in Cancer Biology.
J. D. Potter (2001)
Cancer Epidemiol. Biomarkers Prev. 10, 161-170
   Abstract »    Full Text »
Levels of Hypoxia-Inducible Factor-1{{alpha}} During Breast Carcinogenesis.
R. Bos, H. Zhong, C. F. Hanrahan, E. C. M. Mommers, G. L. Semenza, H. M. Pinedo, M. D. Abeloff, J. W. Simons, P. J. van Diest, and E. van der Wall (2001)
J Natl Cancer Inst 93, 309-314
   Abstract »    Full Text »    PDF »
Biallelic Inactivation of Retinoic Acid Receptor {beta}2 Gene by Epigenetic Change in Breast Cancer.
Q. Yang, I. Mori, L. Shan, M. Nakamura, Y. Nakamura, H. Utsunomiya, G. Yoshimura, T. Suzuma, T. Tamaki, T. Umemura, et al. (2001)
Am. J. Pathol. 158, 299-303
   Abstract »    Full Text »    PDF »
High Frequency of Chromosome 3p Deletion in Histologically Normal Nasopharyngeal Epithelia from Southern Chinese.
A. S. C. Chan, K. F. To, K. W. Lo, K. F. Mak, W. Pak, B. Chiu, G. M. K. Tse, M. Ding, X. Li, J. C. K. Lee, et al. (2000)
Cancer Res. 60, 5365-5370
   Abstract »    Full Text »
Laser capture microdissection in pathology.
F. Fend and M. Raffeld (2000)
J. Clin. Pathol. 53, 666-672
   Abstract »    Full Text »    PDF »
Genetic and Epigenetic Alterations in Normal Bladder Epithelium in Patients with Metachronous Bladder Cancer.
S. Muto, S. Horie, S. Takahashi, K. Tomita, and T. Kitamura (2000)
Cancer Res. 60, 4021-4025
   Abstract »    Full Text »
A Hypersensitive Estrogen Receptor-{{alpha}} Mutation in Premalignant Breast Lesions.
S. A. W. Fuqua, C. Wiltschke, Q. X. Zhang, A. Borg, C. G. Castles, W. E. Friedrichs, T. Hopp, S. Hilsenbeck, S. Mohsin, P. O’Connell, et al. (2000)
Cancer Res. 60, 4026-4029
   Abstract »    Full Text »
Loss of Heterozygosity in Fibrocystic Change of the Breast : Genetic Relationship Between Benign Proliferative Lesions and Associated Carcinomas.
C. Washington, F. Dalbegue, F. Abreo, J. K. Taubenberger, and J. H. Lichy (2000)
Am. J. Pathol. 157, 323-329
   Abstract »    Full Text »    PDF »
Immunohistochemical Analyses of Focal Adhesion Kinase Expression in Benign and Malignant Human Breast and Colon Tissues: Correlation with Preinvasive and Invasive Phenotypes.
W. G. Cance, J. E. Harris, M. V. Iacocca, E. Roche, X. Yang, J. Chang, S. Simkins, and L. Xu (2000)
Clin. Cancer Res. 6, 2417-2423
   Abstract »    Full Text »
Methylation and Silencing of the Retinoic Acid Receptor-{beta}2 Gene in Breast Cancer.
M. Widschwendter, J. Berger, M. Hermann, H. M. Muller, A. Amberger, M. Zeschnigk, A. Widschwendter, B. Abendstein, A. G. Zeimet, G. Daxenbichler, et al. (2000)
J Natl Cancer Inst 92, 826-832
   Abstract »    Full Text »    PDF »
Multiplex Genotype Analysis of Invasive Carcinoma and Accompanying Proliferative Lesions Microdissected from Breast Tissue.
X. Cui, H. Feiner, Z. Lin, and H. Li (2000)
J. Mol. Diagn. 2, 29-36
   Abstract »    Full Text »
Genetic Analysis of Head and Neck Squamous Cell Carcinoma and Surrounding Mucosa.
N. D. Stafford, J. N. E. Ashman, A. W. MacDonald, S. R. Ell, J. R. T. Monson, and J. Greenman (1999)
Arch Otolaryngol Head Neck Surg 125, 1341-1348
   Abstract »    Full Text »    PDF »
Clones and Subclones in the Lung Cancer Field.
W. N. Hittelman (1999)
J Natl Cancer Inst 91, 1796-1799
   Full Text »    PDF »
High Frequency of Allelic Loss of BRCA2 Gene in Pregnancy-Associated Breast Carcinoma.
T. Shen, A. O. Vortmeyer, Z. Zhuang, and F. A. Tavassoli (1999)
J Natl Cancer Inst 91, 1686-1687
   Full Text »    PDF »
Detecting Tumor-related Alterations in Plasma or Serum DNA of Patients Diagnosed with Breast Cancer.
X. q. Chen, H. Bonnefoi, S. Diebold-Berger, J. Lyautey, C. Lederrey, E. Faltin-Traub, M. Stroun, and P. Anker (1999)
Clin. Cancer Res. 5, 2297-2303
   Abstract »    Full Text »    PDF »
Loss of Heterozygosity at D14S62 and Metastatic Potential of Breast Cancer.
P. O'Connell, K. Fischbach, S. Hilsenbeck, S. K. Mohsin, S. A. W. Fuqua, G. M. Clark, C. K. Osborne, and D. C. Allred (1999)
J Natl Cancer Inst 91, 1391-1397
   Abstract »    Full Text »    PDF »
Elevated retinoic acid receptor beta 4 protein in human breast tumor cells with nuclear and cytoplasmic localization.
K. M. Sommer, L. I. Chen, P. M. Treuting, L. T. Smith, and K. Swisshelm (1999)
PNAS 96, 8651-8656
   Abstract »    Full Text »    PDF »
Presence of Tumor DNA in Plasma of Breast Cancer Patients: Clinicopathological Correlations.
J. M. Silva, G. Dominguez, J. M. Garcia, R. Gonzalez, M. J. Villanueva, F. Navarro, M. Provencio, S. San Martin, P. Espana, and F. Bonilla (1999)
Cancer Res. 59, 3251-3256
   Abstract »    Full Text »    PDF »
Retinoic Acid-mediated G1-S-Phase Arrest of Normal Human Mammary Epithelial Cells Is Independent of the Level of p53 Protein Expression.
V. L. Seewaldt, E. C. Dietze, B. S. Johnson, S. J. Collins, and M. B. Parker (1999)
Cell Growth Differ. 10, 49-59
   Abstract »    Full Text »
Immuno-LCM: Laser Capture Microdissection of Immunostained Frozen Sections for mRNA Analysis.
F. Fend, M. R. Emmert-Buck, R. Chuaqui, K. Cole, J. Lee, L. A. Liotta, and M. Raffeld (1999)
Am. J. Pathol. 154, 61-66
   Abstract »    Full Text »    PDF »
Phenotype and Genotype of Advanced Premalignant Head and Neck Lesions After Chemopreventive Therapy.
L. Mao, A. K. El-Naggar, V. Papadimitrakopoulou, D. M. Shin, H. C. Shin, Y. Fan, X. Zhou, G. Clayman, J. J. Lee, J. S. Lee, et al. (1998)
J Natl Cancer Inst 90, 1545-1551
   Abstract »    PDF »
The Long and Short of Chromosome 11 in Breast Cancer.
I. F. Newsham (1998)
Am. J. Pathol. 153, 5-9
   Full Text »    PDF »
Loss of Heterozygosity on Chromosome 11p15 during Histological Progression in Microdissected Ductal Carcinoma of the Breast.
J. H. Lichy, M. Zavar, M. M. Tsai, T. J. O'Leary, and J. K. Taubenberger (1998)
Am. J. Pathol. 153, 271-278
   Abstract »    Full Text »    PDF »
Loss of the gene encoding mannose 6-phosphate/insulin-like growth factor II receptor is an early event in liver carcinogenesis.
T. Yamada, A. T. De Souza, S. Finkelstein, and R. L. Jirtle (1997)
PNAS 94, 10351-10355
   Abstract »    Full Text »    PDF »
Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging.
A. Krtolica, S. Parrinello, S. Lockett, P.-Y. Desprez, and J. Campisi (2001)
PNAS 98, 12072-12077
   Abstract »    Full Text »    PDF »



To Advertise     Find Products

ADVERTISEMENT

Featured Jobs

Science. ISSN 0036-8075 (print), 1095-9203 (online)