Related Content
Search Google Scholar for:
|
|
Science 1 December 1989: Vol. 246. no. 4934, pp. 1158 - 1161 DOI: 10.1126/science.2588000
|
|
Articles
Science, Vol 246, Issue 4934, 1158-1161
Copyright © 1989 by American Association for the Advancement of Science
1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene
NA Morrison,
J Shine,
JC Fragonas,
V Verkest,
ML McMenemy,
and
JA Eisman
Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.
The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES:
- Prolactin Blocks Nuclear Translocation of VDR by Regulating Its Interaction with BRCA1 in Osteosarcoma Cells.
- C. Deng, E. Ueda, K. E. Chen, C. Bula, A. W. Norman, R. A. Luben, and A. M. Walker (2009)
Mol. Endocrinol.
23, 226-236
| Abstract »
| Full Text »
| PDF »
- Involvement of SMRT Corepressor in Transcriptional Repression by the Vitamin D Receptor.
- J. Y. Kim, Y. L. Son, and Y. C. Lee (2009)
Mol. Endocrinol.
23, 251-264
| Abstract »
| Full Text »
| PDF »
- Metabolic Bone Disease in Patients Receiving Home Parenteral Nutrition: A Canadian Study and Review.
- M. Raman, E. Aghdassi, M. Baun, M. Yeung, L. Fairholm, O. Saqui, and J. P. Allard (2006)
JPEN J Parenter Enteral Nutr
30, 492-496
| Abstract »
| Full Text »
| PDF »
- Effects of a {beta}-Blocker on Bone Turnover in Normal Postmenopausal Women: A Randomized Controlled Trial.
- I. R. Reid, J. Lucas, D. Wattie, A. Horne, M. Bolland, G. D. Gamble, J. S. Davidson, and A. B. Grey (2005)
J. Clin. Endocrinol. Metab.
90, 5212-5216
| Abstract »
| Full Text »
| PDF »
- Identification of a Functional Vitamin D Response Element in the Human Insulin-Like Growth Factor Binding Protein-3 Promoter.
- L. Peng, P. J. Malloy, and D. Feldman (2004)
Mol. Endocrinol.
18, 1109-1119
| Abstract »
| Full Text »
| PDF »
- Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS.
- D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao (2004)
J. Biol. Chem.
279, 5329-5337
| Abstract »
| Full Text »
| PDF »
- Osteocrin, a Novel Bone-specific Secreted Protein That Modulates the Osteoblast Phenotype.
- G. Thomas, P. Moffatt, P. Salois, M.-H. Gaumond, R. Gingras, E. Godin, D. Miao, D. Goltzman, and C. Lanctot (2003)
J. Biol. Chem.
278, 50563-50571
| Abstract »
| Full Text »
| PDF »
- G2/M Arrest by 1,25-Dihydroxyvitamin D3 in Ovarian Cancer Cells Mediated through the Induction of GADD45 via an Exonic Enhancer.
- F. Jiang, P. Li, A. J. Fornace Jr., S. V. Nicosia, and W. Bai (2003)
J. Biol. Chem.
278, 48030-48040
| Abstract »
| Full Text »
| PDF »
- Activation of Peroxisome Proliferator-activated Receptor-{gamma} Inhibits the Runx2-mediated Transcription of Osteocalcin in Osteoblasts.
- M. J. Jeon, J. A. Kim, S. H. Kwon, S. W. Kim, K. S. Park, S.-W. Park, S. Y. Kim, and C. S. Shin (2003)
J. Biol. Chem.
278, 23270-23277
| Abstract »
| Full Text »
| PDF »
- Management of corticosteroid-induced osteoporosis.
- S. S. Yeap and D. J. Hosking (2002)
Rheumatology
41, 1088-1094
| Abstract »
| Full Text »
| PDF »
- A Novel Targeting Modality to Enhance Adenoviral Replication by Vitamin D3 in Androgen-independent Human Prostate Cancer Cells and Tumors.
- C.-L. Hsieh, L. Yang, L. Miao, F. Yeung, C. Kao, H. Yang, H. E. Zhau, and L. W. K. Chung (2002)
Cancer Res.
62, 3084-3092
| Abstract »
| Full Text »
| PDF »
- Histone Acetylation in Vivo at the Osteocalcin Locus Is Functionally Linked to Vitamin D-dependent, Bone Tissue-specific Transcription.
- J. Shen, M. Montecino, J. B. Lian, G. S. Stein, A. J. van Wijnen, and J. L. Stein (2002)
J. Biol. Chem.
277, 20284-20292
| Abstract »
| Full Text »
| PDF »
- Combination of 1{alpha},25-Dihydroxyvitamin D3 with Dexamethasone Enhances Cell Cycle Arrest and Apoptosis: Role of Nuclear Receptor Cross-Talk and Erk/Akt Signaling.
- R. J. Bernardi, D. L. Trump, W.-D. Yu, T. F. McGuire, P. A. Hershberger, and C. S. Johnson (2001)
Clin. Cancer Res.
7, 4164-4173
| Abstract »
| Full Text »
| PDF »
- Glucocorticoid Receptor-Interacting Protein-1 and Receptor-Associated Coactivator-3 Differentially Interact with the Vitamin D Receptor (VDR) and Regulate VDR-Retinoid X Receptor Transcriptional Cross-Talk.
- L. L. Issa, G. M. Leong, J. B. Barry, R. L. Sutherland, and J. A. Eisman (2001)
Endocrinology
142, 1606-1615
| Abstract »
| Full Text »
- Repeated immobilization stress reduces rat vertebral bone growth and osteocalcin.
- P. Patterson-Buckendahl, M. Rusnak, K. Fukuhara, and R. Kvetnansky (2001)
Am J Physiol Regulatory Integrative Comp Physiol
280, R79-R86
| Abstract »
| Full Text »
| PDF »
- VDR-Alien: a novel, DNA-selective vitamin D3 receptor-corepressor partnership.
- P. POLLY, M. HERDICK, U. MOEHREN, A. BANIAHMAD, T. HEINZEL, and C. CARLBERG (2000)
FASEB J
14, 1455-1463
| Abstract »
| Full Text »
- Interaction of the effects between vitamin D receptor polymorphism and exercise training on bone metabolism.
- O. Tajima, N. Ashizawa, T. Ishii, H. Amagai, T. Mashimo, L. J. Liu, S. Saitoh, K. Tokuyama, and M. Suzuki (2000)
J Appl Physiol
88, 1271-1276
| Abstract »
| Full Text »
| PDF »
- Characterization of Osf1, an Osteoblast-specific Transcription Factor Binding to a Critical cis-acting Element in the Mouse Osteocalcin Promoters.
- T. Schinke and G. Karsenty (1999)
J. Biol. Chem.
274, 30182-30189
| Abstract »
| Full Text »
| PDF »
- A Two-Hit Mechanism for Vitamin D3-Mediated Transcriptional Repression of the Granulocyte-Macrophage Colony-Stimulating Factor Gene: Vitamin D Receptor Competes for DNA Binding with NFAT1 and Stabilizes c-Jun.
- T. L. Towers, T. P. Staeva, and L. P. Freedman (1999)
Mol. Cell. Biol.
19, 4191-4199
| Abstract »
| Full Text »
| PDF »
- Vitamin D-dependent Suppression of Human Atrial Natriuretic Peptide Gene Promoter Activity Requires Heterodimer Assembly.
- S. Chen, C. H. R. M. Costa, K. Nakamura, R. C. J. Ribeiro, and D. G. Gardner (1999)
J. Biol. Chem.
274, 11260-11266
| Abstract »
| Full Text »
| PDF »
- The Vitamin D Receptor and the Syndrome of Hereditary 1,25-Dihydroxyvitamin D-Resistant Rickets.
- P. J. Malloy, J. W. Pike, and D. Feldman (1999)
Endocr. Rev.
20, 156-188
| Abstract »
| Full Text »
- AP-1 and Vitamin D Receptor (VDR) Signaling Pathways Converge at the Rat Osteocalcin VDR Element: Requirement for the Internal Activating Protein-1 Site for Vitamin D-Mediated Trans-Activation.
- F. Aslam, L. McCabe, B. Frenkel, A. J. van Wijnen, G. S. Stein, J. B. Lian, and J. L. Stein (1999)
Endocrinology
140, 63-70
| Abstract »
| Full Text »
- A Weak TATA Box Is a Prerequisite for Glucocorticoid-dependent Repression of the Osteocalcin Gene.
- T. Meyer, J. Carlstedt-Duke, and D. B. Starr (1997)
J. Biol. Chem.
272, 30709-30714
| Abstract »
| Full Text »
| PDF »
- Human and Murine Osteocalcin Gene Expression: Conserved Tissue Restricted Expression and Divergent Responses to 1,25-Dihydroxyvitamin D3 in Vivo.
- N. A. Sims, C. P. White, K. L. Sunn, G. P. Thomas, M. L. Drummond, N. A. Morrison, J. A. Eisman, and E. M. Gardiner (1997)
Mol. Endocrinol.
11, 1695-1708
| Abstract »
| Full Text »
- Mutations in the Vitamin D Receptor Gene in Three Kindreds Associated with Hereditary Vitamin D Resistant Rickets.
- F. J. Cockerill, N. S. Hawa, N. Yousaf, M. Hewison, J. L H. O'Riordan, and S. M. Farrow (1997)
J. Clin. Endocrinol. Metab.
82, 3156-3160
| Abstract »
| Full Text »
| PDF »
- The Rat Glucocorticoid Receptor Mutant K461A Differentiates between Two Different Mechanisms of Transrepression.
- T. Meyer, D. B. Starr, and J. Carlstedt-Duke (1997)
J. Biol. Chem.
272, 21090-21095
| Abstract »
| Full Text »
| PDF »
- Parathyroid Hormone (PTH 1-34) Regulation of Rat Osteocalcin Gene Transcription.
- X.-P. Yu and S. Chandrasekhar (1997)
Endocrinology
138, 3085-3092
| Abstract »
| Full Text »
| PDF »
- Ascorbic Acid-Dependent Activation of the Osteocalcin Promoter in MC3T3-E1 Preosteoblasts: Requirement for Collagen Matrix Synthesis and the Presence of an Intact OSE2 Sequence.
- G. Xiao, Y. Cui, P. Ducy, G. Karsenty, and R. T. Franceschi (1997)
Mol. Endocrinol.
11, 1103-1113
| Abstract »
| Full Text »
- Expression of Enzymatically Active CYP3A4 by Caco-2 Cells Grown on Extracellular Matrix-Coated Permeable Supports in the Presence of 1alpha ,25-Dihydroxyvitamin D3.
- P. Schmiedlin-Ren, K. E. Thummel, J. M. Fisher, M. F. Paine, K. S. Lown, and P. B. Watkins (1997)
Mol. Pharmacol.
51, 741-754
| Abstract »
| Full Text »
- DNA Sequences Downstream from the Vitamin D Response Element of the Rat Osteocalcin Gene Are Required for Ligand-Dependent Transactivation.
- W. B. Sneddon, C. E. Bogado, M. S. Kiernan, and M. B. Demay (1997)
Mol. Endocrinol.
11, 210-217
| Abstract »
| Full Text »
- YY1 regulates vitamin D receptor/retinoid X receptor mediated transactivation of the vitamin D responsive osteocalcin gene.
- B. Guo, F. Aslam, A. J. van Wijnen, S. G. E. Roberts, B. Frenkel, M. R. Green, H. DeLuca, J. B. Lian, G. S. Stein, and J. L. Stein (1997)
PNAS
94, 121-126
| Abstract »
| Full Text »
| PDF »
- 1,25-Dihydroxyvitamin D3 Inhibits Osteocalcin Expression in Mouse through an Indirect Mechanism.
- R. Zhang, P. Ducy, and G. Karsenty (1997)
J. Biol. Chem.
272, 110-116
| Abstract »
| Full Text »
| PDF »
- Transcriptional Synergism between Vitamin D-responsive Elements in the Rat 25-Hydroxyvitamin D3 24-Hydroxylase (CYP24) Promoter.
- D. M. Kerry, P. P. Dwivedi, C. N. Hahn, H. A. Morris, J. L. Omdahl, and B. K. May (1996)
J. Biol. Chem.
271, 29715-29721
| Abstract »
| Full Text »
| PDF »
- Two Vitamin D Response Elements Function in the Rat 1,25-Dihydroxyvitamin D 24-Hydroxylase Promoter.
- C. Zierold, H. M. Darwish, and H. F. DeLuca (1995)
J. Biol. Chem.
270, 1675-1678
| Abstract »
| Full Text »
| PDF »
- Prevention of Corticosteroid Osteoporosis -- A Comparison of Calcium, Calcitriol, and Calcitonin.
- P. Sambrook, J. Birmingham, P. Kelly, S. Kempler, T. Nguyen, N. Pocock, and J. Eisman (1993)
N. Engl. J. Med.
328, 1747-1752
| Abstract »
| Full Text »
- The basic region of AP-1 specifies glucocorticoid receptor activity at a composite response element..
- J N Miner and K R Yamamoto (1992)
Genes & Dev.
6, 2491-2501
| Abstract »
| PDF »
- Concepts of Osteoblast Growth and Differentiation: Basis for Modulation of Bone Cell Development and Tissue Formation.
- J. B. Lian and G. S. Stein (1992)
Critical Reviews in Oral Biology & Medicine
3, 269-305
| Abstract »
| Full Text »
| PDF »
- Cross-talk between 1,25-Dihydroxyvitamin D3 and Transforming Growth Factor-beta Signaling Requires Binding of VDR and Smad3 Proteins to Their Cognate DNA Recognition Elements.
- N. Subramaniam, G. M. Leong, T.-A. Cock, J. L. Flanagan, C. Fong, J. A. Eisman, and A. P. Kouzmenko (2001)
J. Biol. Chem.
276, 15741-15746
| Abstract »
| Full Text »
| PDF »
- Regulation of Human Osteocalcin Promoter in Hormone-independent Human Prostate Cancer Cells.
- F. Yeung, W. K. Law, C.-H. Yeh, J. J. Westendorf, Y. Zhang, R. Wang, C. Kao, and L. W. K. Chung (2002)
J. Biol. Chem.
277, 2468-2476
| Abstract »
| Full Text »
| PDF »
- In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism.
- T. Meyer, M. Kneissel, J. Mariani, and B. Fournier (2000)
PNAS
97, 9197-9202
| Abstract »
| Full Text »
| PDF »
|
|