Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.

Science 1 December 1989:
Vol. 246. no. 4934, pp. 1158 - 1161
DOI: 10.1126/science.2588000
Prev | Table of Contents | Next

Articles

Science, Vol 246, Issue 4934, 1158-1161
Copyright © 1989 by American Association for the Advancement of Science

articles

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene

NA Morrison, J Shine, JC Fragonas, V Verkest, ML McMenemy, and JA Eisman

Garvan Institute of Medical Research, St. Vincents Hospital, Sydney, Australia.

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.


THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES:
Prolactin Blocks Nuclear Translocation of VDR by Regulating Its Interaction with BRCA1 in Osteosarcoma Cells.
C. Deng, E. Ueda, K. E. Chen, C. Bula, A. W. Norman, R. A. Luben, and A. M. Walker (2009)
Mol. Endocrinol. 23, 226-236
   Abstract »    Full Text »    PDF »
Involvement of SMRT Corepressor in Transcriptional Repression by the Vitamin D Receptor.
J. Y. Kim, Y. L. Son, and Y. C. Lee (2009)
Mol. Endocrinol. 23, 251-264
   Abstract »    Full Text »    PDF »
Metabolic Bone Disease in Patients Receiving Home Parenteral Nutrition: A Canadian Study and Review.
M. Raman, E. Aghdassi, M. Baun, M. Yeung, L. Fairholm, O. Saqui, and J. P. Allard (2006)
JPEN J Parenter Enteral Nutr 30, 492-496
   Abstract »    Full Text »    PDF »
Effects of a {beta}-Blocker on Bone Turnover in Normal Postmenopausal Women: A Randomized Controlled Trial.
I. R. Reid, J. Lucas, D. Wattie, A. Horne, M. Bolland, G. D. Gamble, J. S. Davidson, and A. B. Grey (2005)
J. Clin. Endocrinol. Metab. 90, 5212-5216
   Abstract »    Full Text »    PDF »
Identification of a Functional Vitamin D Response Element in the Human Insulin-Like Growth Factor Binding Protein-3 Promoter.
L. Peng, P. J. Malloy, and D. Feldman (2004)
Mol. Endocrinol. 18, 1109-1119
   Abstract »    Full Text »    PDF »
Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS.
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao (2004)
J. Biol. Chem. 279, 5329-5337
   Abstract »    Full Text »    PDF »
Osteocrin, a Novel Bone-specific Secreted Protein That Modulates the Osteoblast Phenotype.
G. Thomas, P. Moffatt, P. Salois, M.-H. Gaumond, R. Gingras, E. Godin, D. Miao, D. Goltzman, and C. Lanctot (2003)
J. Biol. Chem. 278, 50563-50571
   Abstract »    Full Text »    PDF »
G2/M Arrest by 1,25-Dihydroxyvitamin D3 in Ovarian Cancer Cells Mediated through the Induction of GADD45 via an Exonic Enhancer.
F. Jiang, P. Li, A. J. Fornace Jr., S. V. Nicosia, and W. Bai (2003)
J. Biol. Chem. 278, 48030-48040
   Abstract »    Full Text »    PDF »
Activation of Peroxisome Proliferator-activated Receptor-{gamma} Inhibits the Runx2-mediated Transcription of Osteocalcin in Osteoblasts.
M. J. Jeon, J. A. Kim, S. H. Kwon, S. W. Kim, K. S. Park, S.-W. Park, S. Y. Kim, and C. S. Shin (2003)
J. Biol. Chem. 278, 23270-23277
   Abstract »    Full Text »    PDF »
Management of corticosteroid-induced osteoporosis.
S. S. Yeap and D. J. Hosking (2002)
Rheumatology 41, 1088-1094
   Abstract »    Full Text »    PDF »
A Novel Targeting Modality to Enhance Adenoviral Replication by Vitamin D3 in Androgen-independent Human Prostate Cancer Cells and Tumors.
C.-L. Hsieh, L. Yang, L. Miao, F. Yeung, C. Kao, H. Yang, H. E. Zhau, and L. W. K. Chung (2002)
Cancer Res. 62, 3084-3092
   Abstract »    Full Text »    PDF »
Histone Acetylation in Vivo at the Osteocalcin Locus Is Functionally Linked to Vitamin D-dependent, Bone Tissue-specific Transcription.
J. Shen, M. Montecino, J. B. Lian, G. S. Stein, A. J. van Wijnen, and J. L. Stein (2002)
J. Biol. Chem. 277, 20284-20292
   Abstract »    Full Text »    PDF »
Combination of 1{alpha},25-Dihydroxyvitamin D3 with Dexamethasone Enhances Cell Cycle Arrest and Apoptosis: Role of Nuclear Receptor Cross-Talk and Erk/Akt Signaling.
R. J. Bernardi, D. L. Trump, W.-D. Yu, T. F. McGuire, P. A. Hershberger, and C. S. Johnson (2001)
Clin. Cancer Res. 7, 4164-4173
   Abstract »    Full Text »    PDF »
Glucocorticoid Receptor-Interacting Protein-1 and Receptor-Associated Coactivator-3 Differentially Interact with the Vitamin D Receptor (VDR) and Regulate VDR-Retinoid X Receptor Transcriptional Cross-Talk.
L. L. Issa, G. M. Leong, J. B. Barry, R. L. Sutherland, and J. A. Eisman (2001)
Endocrinology 142, 1606-1615
   Abstract »    Full Text »
Repeated immobilization stress reduces rat vertebral bone growth and osteocalcin.
P. Patterson-Buckendahl, M. Rusnak, K. Fukuhara, and R. Kvetnansky (2001)
Am J Physiol Regulatory Integrative Comp Physiol 280, R79-R86
   Abstract »    Full Text »    PDF »
VDR-Alien: a novel, DNA-selective vitamin D3 receptor-corepressor partnership.
P. POLLY, M. HERDICK, U. MOEHREN, A. BANIAHMAD, T. HEINZEL, and C. CARLBERG (2000)
FASEB J 14, 1455-1463
   Abstract »    Full Text »
Interaction of the effects between vitamin D receptor polymorphism and exercise training on bone metabolism.
O. Tajima, N. Ashizawa, T. Ishii, H. Amagai, T. Mashimo, L. J. Liu, S. Saitoh, K. Tokuyama, and M. Suzuki (2000)
J Appl Physiol 88, 1271-1276
   Abstract »    Full Text »    PDF »
Characterization of Osf1, an Osteoblast-specific Transcription Factor Binding to a Critical cis-acting Element in the Mouse Osteocalcin Promoters.
T. Schinke and G. Karsenty (1999)
J. Biol. Chem. 274, 30182-30189
   Abstract »    Full Text »    PDF »
A Two-Hit Mechanism for Vitamin D3-Mediated Transcriptional Repression of the Granulocyte-Macrophage Colony-Stimulating Factor Gene: Vitamin D Receptor Competes for DNA Binding with NFAT1 and Stabilizes c-Jun.
T. L. Towers, T. P. Staeva, and L. P. Freedman (1999)
Mol. Cell. Biol. 19, 4191-4199
   Abstract »    Full Text »    PDF »
Vitamin D-dependent Suppression of Human Atrial Natriuretic Peptide Gene Promoter Activity Requires Heterodimer Assembly.
S. Chen, C. H. R. M. Costa, K. Nakamura, R. C. J. Ribeiro, and D. G. Gardner (1999)
J. Biol. Chem. 274, 11260-11266
   Abstract »    Full Text »    PDF »
The Vitamin D Receptor and the Syndrome of Hereditary 1,25-Dihydroxyvitamin D-Resistant Rickets.
P. J. Malloy, J. W. Pike, and D. Feldman (1999)
Endocr. Rev. 20, 156-188
   Abstract »    Full Text »
AP-1 and Vitamin D Receptor (VDR) Signaling Pathways Converge at the Rat Osteocalcin VDR Element: Requirement for the Internal Activating Protein-1 Site for Vitamin D-Mediated Trans-Activation.
F. Aslam, L. McCabe, B. Frenkel, A. J. van Wijnen, G. S. Stein, J. B. Lian, and J. L. Stein (1999)
Endocrinology 140, 63-70
   Abstract »    Full Text »
A Weak TATA Box Is a Prerequisite for Glucocorticoid-dependent Repression of the Osteocalcin Gene.
T. Meyer, J. Carlstedt-Duke, and D. B. Starr (1997)
J. Biol. Chem. 272, 30709-30714
   Abstract »    Full Text »    PDF »
Human and Murine Osteocalcin Gene Expression: Conserved Tissue Restricted Expression and Divergent Responses to 1,25-Dihydroxyvitamin D3 in Vivo.
N. A. Sims, C. P. White, K. L. Sunn, G. P. Thomas, M. L. Drummond, N. A. Morrison, J. A. Eisman, and E. M. Gardiner (1997)
Mol. Endocrinol. 11, 1695-1708
   Abstract »    Full Text »
Mutations in the Vitamin D Receptor Gene in Three Kindreds Associated with Hereditary Vitamin D Resistant Rickets.
F. J. Cockerill, N. S. Hawa, N. Yousaf, M. Hewison, J. L H. O'Riordan, and S. M. Farrow (1997)
J. Clin. Endocrinol. Metab. 82, 3156-3160
   Abstract »    Full Text »    PDF »
The Rat Glucocorticoid Receptor Mutant K461A Differentiates between Two Different Mechanisms of Transrepression.
T. Meyer, D. B. Starr, and J. Carlstedt-Duke (1997)
J. Biol. Chem. 272, 21090-21095
   Abstract »    Full Text »    PDF »
Parathyroid Hormone (PTH 1-34) Regulation of Rat Osteocalcin Gene Transcription.
X.-P. Yu and S. Chandrasekhar (1997)
Endocrinology 138, 3085-3092
   Abstract »    Full Text »    PDF »
Ascorbic Acid-Dependent Activation of the Osteocalcin Promoter in MC3T3-E1 Preosteoblasts: Requirement for Collagen Matrix Synthesis and the Presence of an Intact OSE2 Sequence.
G. Xiao, Y. Cui, P. Ducy, G. Karsenty, and R. T. Franceschi (1997)
Mol. Endocrinol. 11, 1103-1113
   Abstract »    Full Text »
Expression of Enzymatically Active CYP3A4 by Caco-2 Cells Grown on Extracellular Matrix-Coated Permeable Supports in the Presence of 1alpha ,25-Dihydroxyvitamin D3.
P. Schmiedlin-Ren, K. E. Thummel, J. M. Fisher, M. F. Paine, K. S. Lown, and P. B. Watkins (1997)
Mol. Pharmacol. 51, 741-754
   Abstract »    Full Text »
DNA Sequences Downstream from the Vitamin D Response Element of the Rat Osteocalcin Gene Are Required for Ligand-Dependent Transactivation.
W. B. Sneddon, C. E. Bogado, M. S. Kiernan, and M. B. Demay (1997)
Mol. Endocrinol. 11, 210-217
   Abstract »    Full Text »
YY1 regulates vitamin D receptor/retinoid X receptor mediated transactivation of the vitamin D responsive osteocalcin gene.
B. Guo, F. Aslam, A. J. van Wijnen, S. G. E. Roberts, B. Frenkel, M. R. Green, H. DeLuca, J. B. Lian, G. S. Stein, and J. L. Stein (1997)
PNAS 94, 121-126
   Abstract »    Full Text »    PDF »
1,25-Dihydroxyvitamin D3 Inhibits Osteocalcin Expression in Mouse through an Indirect Mechanism.
R. Zhang, P. Ducy, and G. Karsenty (1997)
J. Biol. Chem. 272, 110-116
   Abstract »    Full Text »    PDF »
Transcriptional Synergism between Vitamin D-responsive Elements in the Rat 25-Hydroxyvitamin D3 24-Hydroxylase (CYP24) Promoter.
D. M. Kerry, P. P. Dwivedi, C. N. Hahn, H. A. Morris, J. L. Omdahl, and B. K. May (1996)
J. Biol. Chem. 271, 29715-29721
   Abstract »    Full Text »    PDF »
Two Vitamin D Response Elements Function in the Rat 1,25-Dihydroxyvitamin D 24-Hydroxylase Promoter.
C. Zierold, H. M. Darwish, and H. F. DeLuca (1995)
J. Biol. Chem. 270, 1675-1678
   Abstract »    Full Text »    PDF »
Prevention of Corticosteroid Osteoporosis -- A Comparison of Calcium, Calcitriol, and Calcitonin.
P. Sambrook, J. Birmingham, P. Kelly, S. Kempler, T. Nguyen, N. Pocock, and J. Eisman (1993)
N. Engl. J. Med. 328, 1747-1752
   Abstract »    Full Text »
The basic region of AP-1 specifies glucocorticoid receptor activity at a composite response element..
J N Miner and K R Yamamoto (1992)
Genes & Dev. 6, 2491-2501
   Abstract »    PDF »
Concepts of Osteoblast Growth and Differentiation: Basis for Modulation of Bone Cell Development and Tissue Formation.
J. B. Lian and G. S. Stein (1992)
Critical Reviews in Oral Biology & Medicine 3, 269-305
   Abstract »    Full Text »    PDF »
Cross-talk between 1,25-Dihydroxyvitamin D3 and Transforming Growth Factor-beta Signaling Requires Binding of VDR and Smad3 Proteins to Their Cognate DNA Recognition Elements.
N. Subramaniam, G. M. Leong, T.-A. Cock, J. L. Flanagan, C. Fong, J. A. Eisman, and A. P. Kouzmenko (2001)
J. Biol. Chem. 276, 15741-15746
   Abstract »    Full Text »    PDF »
Regulation of Human Osteocalcin Promoter in Hormone-independent Human Prostate Cancer Cells.
F. Yeung, W. K. Law, C.-H. Yeh, J. J. Westendorf, Y. Zhang, R. Wang, C. Kao, and L. W. K. Chung (2002)
J. Biol. Chem. 277, 2468-2476
   Abstract »    Full Text »    PDF »
In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism.
T. Meyer, M. Kneissel, J. Mariani, and B. Fournier (2000)
PNAS 97, 9197-9202
   Abstract »    Full Text »    PDF »


To Advertise     Find Products

Science. ISSN 0036-8075 (print), 1095-9203 (online)